translation and leucine
François Le Fèvre <[email protected]>
| Newsgroups | gmane.comp.java.bio.general |
|---|---|
| Message-ID | <[email protected]> |
Dear all,
i have a quick question about translation with biojava 3
I would like to retrieve that the codon CTA is coding for a leucine.
But some leucine codons code also for a start in Universal Genetic code
Here I have build a very short example:
given a short dna sequence coomposed of a start codon and 6 leucine codons
TranscriptionEngine e = TranscriptionEngine.getDefault();
DNASequence dd = new DNASequence("ATGTTGTTACTTCTCCTACTG");
//return MLLLLLL : OK
DNASequence dd = new DNASequence("CTATTGTTACTTCTCCTACTG");
//return MLLLLLL : KO I would prefer have LLLLLLL !
DNASequence dd = new DNASequence("CTA");
//return M : KO I would prefer have L !
Could someone explain me this feature ?
How the default transcritionEngine works?
How can I ask to the TranscriptionEngine give me the aminoacids
corresponding to CTA when it is not in first position?
Thanks a lot for your help !
Francois
_______________________________________________
Biojava-l mailing list - [email protected]
http://lists.open-bio.org/mailman/listinfo/biojava-l