Re: IndexOutOfBounds Exception when performing Pairwise Alignment

Hannes Brandstätter-Müller <[email protected]>
Newsgroups gmane.comp.java.bio.general
Message-ID <CAPXi2mmXQxeCb5GXXzVYm-VEYCt40uWJMkSYipa+tTW7mKrXXg@mail.gmail.com>
another update: that most recent exception was caused by a reference
sequence consisting only of "NNNN" - looks like something that should
be handled more gracefully to me :)

Hannes

On Tue, Dec 6, 2011 at 09:59, Hannes Brandstätter-Müller
<[email protected]> wrote:
> Hah, I got some not-null results:
>
>
> On Tue, Dec 6, 2011 at 09:20, Hannes Brandstätter-Müller
> <[email protected]> wrote:
>>
>> public void testPSA() {
>>        String targetSeq =
>> "CACGTTTCTTGTGGCAGCTTAAGTTTGAATGTCATTTCTTCAATGGGACGGA"
>>                +
>> "GCGGGTGCGGTTGCTGGAAAGATGCATCTATAACCAAGAGGAGTCCGTGCGCTTCGACAGC"
>>                +
>> "GACGTGGGGGAGTACCGGGCGGTGACGGAGCTGGGGCGGCCTGATGCCGAGTACTGGAACA"
>>                +
>> "GCCAGAAGGACCTCCTGGAGCAGAGGCGGGCCGCGGTGGACACCTACTGCAGACACAACTA"
>>                + "CGGGGTTGGTGAGAGCTTCACAGTGCAGCGGCGAG";
>>        DNASequence target = new DNASequence(targetSeq,
>> AmbiguityDNACompoundSet.getDNACompoundSet());
>>        String querySeq =
>> "ACGAGTGCGTGTTTTCCCGCCTGGTCCCCAGGCCCCCTTTCCGTCCTCAGGAA"
>>                +
>> "GACAGAGGAGGAGCCCCTCGGGCTGCAGGTGGTGGGCGTTGCGGCGGCGGCCGGTTAAGGT"
>>                +
>> "TCCCAGTGCCCGCACCCGGCCCACGGGAGCCCCGGACTGGCGGCGTCACTGTCAGTGTCTT"
>>                +
>> "CTCAGGAGGCCGCCTGTGTGACTGGATCGTTCGTGTCCCCACAGCACGTTTCTTGGAGTAC"
>>                +
>> "TCTACGTCTGAGTGTCATTTCTTCAATGGGACGGAGCGGGTGCGGTTCCTGGACAGATACT"
>>                +
>> "TCCATAACCAGGAGGAGAACGTGCGCTTCGACAGCGACGTGGGGGAGTTCCGGGCGGTGAC"
>>                +
>> "GGAGCTGGGGCGGCCTGATGCCGAGTACTGGAACAGCCAGAAGGACATCCTGGAAGACGAG"
>>                +
>> "CGGGCCGCGGTGGACACCTACTGCAGACACAACTACGGGGTTGTGAGAGCTTCACCGTGCA"
>>                + "GCGGCGAGACGCACTCGT";
>>        DNASequence query = new DNASequence(querySeq);
>
> query.setCompoundSet(AmbiguityDNACompoundSet.getDNACompoundSet()); //
> inserting that helps.
>
>>        SubstitutionMatrix<NucleotideCompound> matrix =
>> SubstitutionMatrixHelper.getNuc4_4();
>>        SequencePair<DNASequence, NucleotideCompound> psa =
>> Alignments.getPairwiseAlignment(query, target,
>> PairwiseSequenceAlignerType.LOCAL, new SimpleGapPenalty(), matrix);
>>        assertNotNull(psa);
>>    }
>
> But when I try something similar in my production code, I get an
> java.lang.IndexOutOfBoundsException: Index: 0, Size: 0 again
>
> dnaSequence.setCompoundSet(AmbiguityDNACompoundSet.getDNACompoundSet());
> // If I remove this line, the exception is gone again, but I get NULL
> result.
> psa = Alignments.getPairwiseAlignment(dnaSequence, target,
> PairwiseSequenceAlignerType.LOCAL, new SimpleGapPenalty(), matrix);
>
> the dnaSequence in that case is something that is passed to this
> method, and is a sequence generated by a fasta reader - should have no
> ambiguity in there, just plain ACGT. It has a plain DNACompoundSet
> too.
>
> Hannes
>

_______________________________________________
Biojava-l mailing list  -  [email protected]
http://lists.open-bio.org/mailman/listinfo/biojava-l
lmpx.com only provides a reader for public news (NNTP) servers. It is not affiliated with the servers or forums shown here and is not responsible for the content of articles, which is written by their respective authors.