Nitrogen fixation in a landrace of maize is supported by a mucilage-associated diazotrophic microbiota
Lawrence London <[email protected]> Fri, 10 Aug 2018 14:30:20 -0400
| Newsgroups | gmane.politics.activism.permaculture |
|---|---|
| Message-ID | <CA+j2Q+B41ZAh_HXEGHeLc-uPLSWt4DieTgQzZ+KYKitsE2swag@mail.gmail.com> |
Nitrogen fixation in a landrace of maize is supported by a
mucilage-associated diazotrophic microbiota
http://journals.plos.org/plosbiology/article?id=10.1371/journal.pbio.2006352
Open Access
Peer-reviewed
Research Article
Nitrogen fixation in a landrace of maize is supported by a
mucilage-associated diazotrophic microbiota
- Allen Van Deynze ,
- Pablo Zamora ,
- Pierre-Marc Delaux ,
- Cristobal Heitmann †,
- Dhileepkumar Jayaraman,
- Shanmugam Rajasekar,
- Danielle Graham,
- Junko Maeda,
- Donald Gibson,
- Kevin D. Schwartz,
- Alison M. Berry,
- Srijak Bhatnagar,
- Guillaume Jospin,
- Aaron Darling,
- Richard Jeannotte,
- Javier Lopez,
- Bart C. Weimer,
- Jonathan A. Eisen,
- Howard-Yana Shapiro,
- Jean-Michel Ané,
- Alan B. Bennett
-
-
-
[image: PLOS]
- Published: August 7, 2018
- https://doi.org/10.1371/journal.pbio.2006352
- Article
<http://journals.plos.org/plosbiology/article?id=10.1371/journal.pbio.2006352>
- Authors
<http://journals.plos.org/plosbiology/article/authors?id=10.1371/journal.pbio.2006352>
- Metrics
<http://journals.plos.org/plosbiology/article/metrics?id=10.1371/journal.pbio.2006352>
- Comments
<http://journals.plos.org/plosbiology/article/comments?id=10.1371/journal.pbio.2006352>
- Related Content
<http://journals.plos.org/plosbiology/article/related?id=10.1371/journal.pbio.2006352>
- Abstract
<http://journals.plos.org/plosbiology/article?id=10.1371/journal.pbio.2006352#abstract0>
- Author summary
<http://journals.plos.org/plosbiology/article?id=10.1371/journal.pbio.2006352#abstract1>
- Introduction
<http://journals.plos.org/plosbiology/article?id=10.1371/journal.pbio.2006352#sec001>
- Results
<http://journals.plos.org/plosbiology/article?id=10.1371/journal.pbio.2006352#sec002>
- Discussion
<http://journals.plos.org/plosbiology/article?id=10.1371/journal.pbio.2006352#sec006>
- Materials and methods
<http://journals.plos.org/plosbiology/article?id=10.1371/journal.pbio.2006352#sec007>
- Supporting information
<http://journals.plos.org/plosbiology/article?id=10.1371/journal.pbio.2006352#sec025>
- Acknowledgments
<http://journals.plos.org/plosbiology/article?id=10.1371/journal.pbio.2006352#ack>
- References
<http://journals.plos.org/plosbiology/article?id=10.1371/journal.pbio.2006352#references>
- Reader Comments (0)
<http://journals.plos.org/plosbiology/article/comments?id=10.1371/journal.pbio.2006352>
- Media Coverage (0)
<http://journals.plos.org/plosbiology/article/related?id=10.1371/journal.pbio.2006352>
- Figures
<http://journals.plos.org/plosbiology/article?id=10.1371/journal.pbio.2006352#>
Abstract
Plants are associated with a complex microbiota that contributes to
nutrient acquisition, plant growth, and plant defense. Nitrogen-fixing
microbial associations are efficient and well characterized in legumes but
are limited in cereals, including maize. We studied an indigenous landrace
of maize grown in nitrogen-depleted soils in the Sierra Mixe region of
Oaxaca, Mexico. This landrace is characterized by the extensive development
of aerial roots that secrete a carbohydrate-rich mucilage. Analysis of the
mucilage microbiota indicated that it was enriched in taxa for which many
known species are diazotrophic, was enriched for homologs of genes encoding
nitrogenase subunits, and harbored active nitrogenase activity as assessed
by acetylene reduction and 15N2 incorporation assays. Field experiments in
Sierra Mixe using 15N natural abundance or 15N-enrichment assessments over
5 years indicated that atmospheric nitrogen fixation contributed 29%–82% of
the nitrogen nutrition of Sierra Mixe maize.
Author summary
Nitrogen is an essential nutrient for plants, and for many nonlegume crops,
the requirement for nitrogen is primarily met by the use of inorganic
fertilizers. These fertilizers are produced from fossil fuel by
energy-intensive processes that are estimated to use 1% to 2% of the total
global energy supply and produce an equivalent share of greenhouse gases.
Because maize (*Zea mays L*.) is a significant recipient of nitrogen
fertilization, a research goal for decades has been to identify or engineer
mechanisms for biological fixation of atmospheric nitrogen in association
with this crop. We hypothesized that isolated indigenous landraces of maize
grown using traditional practices with little or no fertilizer might have
evolved strategies to improve plant performance under low-nitrogen nutrient
conditions. Here, we show that for one such maize landrace grown in
nitrogen-depleted fields near Oaxaca, Mexico, 29%–82% of the plant nitrogen
is derived from atmospheric nitrogen. High levels of nitrogen fixation are
supported, at least in part, by the abundant production of a sugar-rich
mucilage associated with aerial roots that provides a home to a complex
nitrogen-fixing microbiome.
Figures
[image: Table 2]
[image: Fig 1]
[image: Fig 2]
[image: Fig 3]
[image: Fig 4]
[image: Fig 5]
[image: Table 1]
[image: Table 2]
[image: Fig 1]
[image: Fig 2]
[image: Fig 3]
*Citation: *Van Deynze A, Zamora P, Delaux P-M, Heitmann C, Jayaraman D,
Rajasekar S, et al. (2018) Nitrogen fixation in a landrace of maize is
supported by a mucilage-associated diazotrophic microbiota. PLoS Biol
16(8): e2006352. https://doi.org/10.1371/journal.pbio.2006352
*Academic Editor: *Eric Kemen, University of Tübingen, Germany
*Received: *April 13, 2018; *Accepted: *July 3, 2018; *Published: * August
7, 2018
*Copyright: * © 2018 Van Deynze et al. This is an open access article
distributed under the terms of the Creative Commons Attribution License
<http://creativecommons.org/licenses/by/4.0/>, which permits unrestricted
use, distribution, and reproduction in any medium, provided the original
author and source are credited.
*Data Availability: *All numerical data are now posted at DOI:
10.6084/m9.figshare.6534545 <https://doi.org/10.6084/m9.figshare.6534545>
and all DNA/RNA sequence data at https://figshare.com/s/04997ae7f7d18b53174a
.
*Funding: *Mars, Incorporated http://www.mars.com/global. The research was
funded by an unrestricted gift and a grant to ABB. The funder had no role
in study design, data collection and analysis, decision to publish, or
preparation of the manuscript. The research was funded by grants to ABB
from BioN2, Incorporated. The funder had no role in study design, data
collection and analysis, decision to publish, or preparation of the
manuscript. Preliminary research was supported by a Dissertation Research
Grant from UC Mexus to KS. The funder had no role in study design, data
collection and analysis, decision to publish, or preparation of the
manuscript.
*Competing interests: * Howard-Yana Shapiro is affiliated with Mars,
Incorporated, one of the research sponsors. Author Cristobal Heitmann was
unable to confirm authorship or contributions himself, and this was carried
out collectively by the other co-authors.
*Abbreviations: *%Ndfa, percent of nitrogen derived from the atmosphere;
%Ndiff, percent total nitrogen difference; ARA, acetylene reduction assay;
CCRC, Complex Carbohydrate Center Research Center; GC/MS, gas
chromatography/mass spectrometry; IRMS, isotope-ratio mass spectrometry;
NPGS, National Plant Germplasm System; PCoA, principal component analysis;
TMS, trimethylsilyl
Introduction
Plants grow in close association with microbial communities that influence
plant traits related to nutrient acquisition, plant development, plant
defenses, and abiotic stress responses. The root-associated microbiota of
plants has been characterized and shown to be much less complex than the
microbiota of the surrounding soil, being enriched in Proteobacteria,
Bacteroidetes, and Actinobacteria. These microbes are selected in part by
plant cell wall features and metabolic cues from host cells [1
<http://journals.plos.org/plosbiology/article?id=10.1371/journal.pbio.2006352#pbio.2006352.ref001>
,2
<http://journals.plos.org/plosbiology/article?id=10.1371/journal.pbio.2006352#pbio.2006352.ref002>].
Characterization of the rhizosphere microbiome associated with 27 modern
maize (*Z*. *mays*) inbred lines also indicated substantial differences in
relative abundance of microbial taxa between bulk soil and the rhizosphere,
with the maize genotype contributing a small but significant influence on
rhizosphere selectivity [3
<http://journals.plos.org/plosbiology/article?id=10.1371/journal.pbio.2006352#pbio.2006352.ref003>
].
Nitrogen-fixing microbial associations with nonlegumes, especially cereals,
have been a topic of intense interest for more than a century [4
<http://journals.plos.org/plosbiology/article?id=10.1371/journal.pbio.2006352#pbio.2006352.ref004>
–7
<http://journals.plos.org/plosbiology/article?id=10.1371/journal.pbio.2006352#pbio.2006352.ref007>].
Nitrogen-fixing endophytes contribute to the nitrogen nutrition of
sugarcane in some environments [8
<http://journals.plos.org/plosbiology/article?id=10.1371/journal.pbio.2006352#pbio.2006352.ref008>
–10
<http://journals.plos.org/plosbiology/article?id=10.1371/journal.pbio.2006352#pbio.2006352.ref010>],
but there is less evidence for the occurrence of efficient diazotrophic
associations in other cereals. A 1-year study based on 15N dilution
experiments in *Miscanthus × giganteus* suggested that this perennial
bioenergy feedstock can acquire about 16% of its nitrogen from the air [11
<http://journals.plos.org/plosbiology/article?id=10.1371/journal.pbio.2006352#pbio.2006352.ref011>].
It has also been demonstrated that the model cereal, *Setaria viridis*, as
well as *Setaria italica* (foxtail millet) can acquire a significant amount
of fixed nitrogen from associations with *Azospirillum brasilense*[12
<http://journals.plos.org/plosbiology/article?id=10.1371/journal.pbio.2006352#pbio.2006352.ref012>
,13
<http://journals.plos.org/plosbiology/article?id=10.1371/journal.pbio.2006352#pbio.2006352.ref013>].
Other examples of fixed atmospheric N2 being transferred to cereals include
associations between *Azoarcus* sp. strain BH72 and Kallar grass [14
<http://journals.plos.org/plosbiology/article?id=10.1371/journal.pbio.2006352#pbio.2006352.ref014>],
*Herbaspirillum seropedicae* and rice [15
<http://journals.plos.org/plosbiology/article?id=10.1371/journal.pbio.2006352#pbio.2006352.ref015>
,16
<http://journals.plos.org/plosbiology/article?id=10.1371/journal.pbio.2006352#pbio.2006352.ref016>],
and *Klebsiella pneumoniae* and wheat [17
<http://journals.plos.org/plosbiology/article?id=10.1371/journal.pbio.2006352#pbio.2006352.ref017>].
Because of its economic importance, the search for diazotrophic
associations with maize (*Z*. *mays*) [18
<http://journals.plos.org/plosbiology/article?id=10.1371/journal.pbio.2006352#pbio.2006352.ref018>]
has been a “holy grail” for decades, and several studies examined the
contribution of nitrogen fixation by *H*. *seropedicae* and *Azospirillum*
sp. to various maize accessions [19
<http://journals.plos.org/plosbiology/article?id=10.1371/journal.pbio.2006352#pbio.2006352.ref019>
,20
<http://journals.plos.org/plosbiology/article?id=10.1371/journal.pbio.2006352#pbio.2006352.ref020>].
However, it is often difficult in these studies to distinguish the general
plant growth–promoting benefits of these diazotrophic bacteria on yield
from an actual transfer of fixed nitrogen to host plants. Five techniques
are commonly used to evaluate nitrogen fixation: acetylene reduction assays
(ARAs), 15N natural abundance, 15N enrichment, 15N2 gas enrichment, and
nitrogen balance experiments [21
<http://journals.plos.org/plosbiology/article?id=10.1371/journal.pbio.2006352#pbio.2006352.ref021>
,22
<http://journals.plos.org/plosbiology/article?id=10.1371/journal.pbio.2006352#pbio.2006352.ref022>].
All of these approaches have potential pitfalls, yet very few studies have
compared different techniques or conducted assessments over multiple years
to evaluate nitrogen fixation in nonlegumes.
Triplett suggested that it may be interesting to survey primitive maize
landraces from the areas of maize origin to identify maize diazotrophic
endophytes [5
<http://journals.plos.org/plosbiology/article?id=10.1371/journal.pbio.2006352#pbio.2006352.ref005>].
Estrada and colleagues [23
<http://journals.plos.org/plosbiology/article?id=10.1371/journal.pbio.2006352#pbio.2006352.ref023>]
followed this suggestion and examined a landrace of maize in the Sierra
Mixe region of Oaxaca, Mexico, and isolated a nitrogen-fixing endophyte
from the resident maize landrace. The isolate was tentatively identified as
a new species of *Burkholderia*, but the contribution of atmospheric
dinitrogen (N2) to the nitrogen economy of the plant was not tested. This
group also reported the isolation of a similar endophyte from field-grown
teosinte plants and speculated that the *Burkholderia* strain might have
formed a primitive symbiosis with teosinte that persisted during
domestication of maize.
We also learned of isolated indigenous landraces of maize in the Sierra
Mixe region of Oaxaca that were reportedly grown using traditional
practices with little or no fertilizer and speculated that unique microbial
community associations, not found in cultivated maize, might have evolved.
This indigenous maize landrace is characterized by the extensive
development of aerial roots that produce large amounts of mucilage.
Mucilage associated with maize underground roots has been previously
described [24
<http://journals.plos.org/plosbiology/article?id=10.1371/journal.pbio.2006352#pbio.2006352.ref024>
,25
<http://journals.plos.org/plosbiology/article?id=10.1371/journal.pbio.2006352#pbio.2006352.ref025>],
and it has been suggested that root exudates play a significant role in
structuring rhizosphere microbial communities [26
<http://journals.plos.org/plosbiology/article?id=10.1371/journal.pbio.2006352#pbio.2006352.ref026>
,27
<http://journals.plos.org/plosbiology/article?id=10.1371/journal.pbio.2006352#pbio.2006352.ref027>].
Indeed, it has been shown that pea root mucilage can serve as a sole carbon
source for some rhizosphere bacteria, including *Rhizobium* sp.,
*Burkholderia* sp., and *Pseudomonas* sp. [28
<http://journals.plos.org/plosbiology/article?id=10.1371/journal.pbio.2006352#pbio.2006352.ref028>].
Aerial roots at the base of the maize shoot, also known as brace roots or
nodal adventitious roots, can often reach the ground and are thought to
provide anchorage to prevent lodging but may also contribute to nutrient
and water uptake as well as gas exchange [29
<http://journals.plos.org/plosbiology/article?id=10.1371/journal.pbio.2006352#pbio.2006352.ref029>
–31
<http://journals.plos.org/plosbiology/article?id=10.1371/journal.pbio.2006352#pbio.2006352.ref031>].
However, very little is known about the role of aerial roots that do not
reach the ground and the mucilage that they produce. Here, we demonstrate
that a Mexican maize landrace can acquire 29%–82% of its nitrogen from the
air and that at least some of this N is fixed by diazotrophic bacteria
present in the mucilage of aerial roots.
Results
Sierra Mixe maize morphology and mucilage
The Sierra Mixe maize varieties cultured locally—referred to as Rojo,
Piedra Blanca, and Llano—share similar plant morphologies, growing to a
height of over 5 meters and exhibiting extensive aerial root formation at
each node. We compared the development of aerial roots in the Sierra Mixe
maize with another tall maize variety, Hickory King (Fig 1A
<http://journals.plos.org/plosbiology/article?id=10.1371/journal.pbio.2006352#pbio-2006352-g001>).
Unlike most modern maize varieties in which aerial root formation ceases
after the juvenile-to-adult transition (arrow, Fig 1A
<http://journals.plos.org/plosbiology/article?id=10.1371/journal.pbio.2006352#pbio-2006352-g001>),
aerial root formation in Sierra Mixe maize continued well after this
transition, resulting in a 3- to 4-fold greater number of aerial roots (Fig
1B
<http://journals.plos.org/plosbiology/article?id=10.1371/journal.pbio.2006352#pbio-2006352-g001>).
Approximately midway through development (July to September), these maize
aerial roots secrete significant amounts of mucilage that is rich in
arabinose, fucose, and galactose when moisture is available (Fig 2
<http://journals.plos.org/plosbiology/article?id=10.1371/journal.pbio.2006352#pbio-2006352-g002>).
The sugars comprise a complex polysaccharide that presumably contributes to
the viscosity of the mucilage and may be disassembled to provide
monosaccharides to support microbial growth and metabolism. Mucilage
produced by underground maize roots also contain high levels of fucose and
arabinose [32
<http://journals.plos.org/plosbiology/article?id=10.1371/journal.pbio.2006352#pbio.2006352.ref032>],
although at approximately one-half the concentration found in aerial root
mucilage.
[image: thumbnail]
<http://journals.plos.org/plosbiology/article/figure/image?size=medium&id=info:doi/10.1371/journal.pbio.2006352.g001>
Download:
- PPT
<http://journals.plos.org/plosbiology/article/figure/powerpoint?id=info:doi/10.1371/journal.pbio.2006352.g001>
PowerPoint slide
<http://journals.plos.org/plosbiology/article/figure/powerpoint?id=info:doi/10.1371/journal.pbio.2006352.g001>
- PNG
<http://journals.plos.org/plosbiology/article/figure/image?download&size=large&id=info:doi/10.1371/journal.pbio.2006352.g001>
larger image
<http://journals.plos.org/plosbiology/article/figure/image?download&size=large&id=info:doi/10.1371/journal.pbio.2006352.g001>
- TIFF
<http://journals.plos.org/plosbiology/article/figure/image?download&size=original&id=info:doi/10.1371/journal.pbio.2006352.g001>
original image
<http://journals.plos.org/plosbiology/article/figure/image?download&size=original&id=info:doi/10.1371/journal.pbio.2006352.g001>
Fig 1. Physiological features of Sierra Mixe maize.
(A) The transition between juvenile and adult phases (black arrow) occurs 5
weeks after planting in Sierra Mixe maize (black bars) and in the tall
maize heirloom Hickory King (gray bars). (B) Number of aerial roots
observed on Sierra Mixe maize and Hickory King after 14 weeks of growth in
the field in Madison, United States of America. Error bars represent
standard errors; an asterisk indicates a significant difference between
Sierra Mixe maize and Hickory King (Student *t* test, *P* < 0.01). (Data at
DOI: 10.6084/m9.figshare.6534545
<https://doi.org/10.6084/m9.figshare.6534545>).
https://doi.org/10.1371/journal.pbio.2006352.g001
[image: thumbnail]
<http://journals.plos.org/plosbiology/article/figure/image?size=medium&id=info:doi/10.1371/journal.pbio.2006352.g002>
Download:
- PPT
<http://journals.plos.org/plosbiology/article/figure/powerpoint?id=info:doi/10.1371/journal.pbio.2006352.g002>
PowerPoint slide
<http://journals.plos.org/plosbiology/article/figure/powerpoint?id=info:doi/10.1371/journal.pbio.2006352.g002>
- PNG
<http://journals.plos.org/plosbiology/article/figure/image?download&size=large&id=info:doi/10.1371/journal.pbio.2006352.g002>
larger image
<http://journals.plos.org/plosbiology/article/figure/image?download&size=large&id=info:doi/10.1371/journal.pbio.2006352.g002>
- TIFF
<http://journals.plos.org/plosbiology/article/figure/image?download&size=original&id=info:doi/10.1371/journal.pbio.2006352.g002>
original image
<http://journals.plos.org/plosbiology/article/figure/image?download&size=original&id=info:doi/10.1371/journal.pbio.2006352.g002>
Fig 2. Aerial root mucilage.
The aerial roots of Sierra Mixe maize (left) secrete large quantities of
mucilage between 3 and 6 months after planting. The mucilage is
carbohydrate rich, with the composition dominated by arabinose, fucose, and
galactose (side panel).
https://doi.org/10.1371/journal.pbio.2006352.g002
Sierra Mixe maize diazotrophic microbiota
The microbiota associated with the underground and aerial roots, stems, and
aerial root mucilage of Sierra Mixe maize grown in Sierra Mixe was
investigated by amplifying and sequencing of 16S rRNA genes and by shotgun
metagenome sequencing. The rhizosphere samples were the most diverse, and
among plant samples, the aerial root mucilage had the highest diversity (S1
Fig
<http://journals.plos.org/plosbiology/article?id=10.1371/journal.pbio.2006352#pbio.2006352.s001>)
and a higher relative abundance of bacteroidetes and proteobacteria (beta
and gamma) compared to other parts of the plants (S2 Fig
<http://journals.plos.org/plosbiology/article?id=10.1371/journal.pbio.2006352#pbio.2006352.s002>).
Many of the lineages that are overrepresented in mucilage include known
plant-associated nitrogen fixers. A comparison of samples based on the
total community composition showed a clustering of mucilage samples that
were statistically distinct from the rest of the plant and rhizosphere
samples (Fig 3A
<http://journals.plos.org/plosbiology/article?id=10.1371/journal.pbio.2006352#pbio-2006352-g003>).
Clustering of samples based upon the variance-stabilized abundance of
sequence variants again indicates that while the rhizosphere samples were
distinct and diverse, the mucilage samples were distant from the other
plant tissues (S3 Fig
<http://journals.plos.org/plosbiology/article?id=10.1371/journal.pbio.2006352#pbio.2006352.s003>).
The complete list of all sequence variants identified in the Sierra Mixe
maize and soil samples can be found at (DOI: 10.6084/m9.figshare.4789759
<https://doi.org/10.6084/m9.figshare.4789759>). Additionally, the
metagenomic data was searched for homologs of the 6 core *nif* genes as
described by Dos Santos and colleagues [33
<http://journals.plos.org/plosbiology/article?id=10.1371/journal.pbio.2006352#pbio.2006352.ref033>].
This search revealed the presence of all 6 core *nif* genes in the
metagenomes from mucilage and rhizosphere and only a subset of the 6 core
*nif* genes from stem tissue (Fig 3B
<http://journals.plos.org/plosbiology/article?id=10.1371/journal.pbio.2006352#pbio-2006352-g003>).
A higher normalized abundance of most *nif* genes (except *nifD*) in
mucilage than stem tissues suggests that the mucilage may be enriched in
nitrogen-fixing microbes.
[image: thumbnail]
<http://journals.plos.org/plosbiology/article/figure/image?size=medium&id=info:doi/10.1371/journal.pbio.2006352.g003>
Download:
- PPT
<http://journals.plos.org/plosbiology/article/figure/powerpoint?id=info:doi/10.1371/journal.pbio.2006352.g003>
PowerPoint slide
<http://journals.plos.org/plosbiology/article/figure/powerpoint?id=info:doi/10.1371/journal.pbio.2006352.g003>
- PNG
<http://journals.plos.org/plosbiology/article/figure/image?download&size=large&id=info:doi/10.1371/journal.pbio.2006352.g003>
larger image
<http://journals.plos.org/plosbiology/article/figure/image?download&size=large&id=info:doi/10.1371/journal.pbio.2006352.g003>
- TIFF
<http://journals.plos.org/plosbiology/article/figure/image?download&size=original&id=info:doi/10.1371/journal.pbio.2006352.g003>
original image
<http://journals.plos.org/plosbiology/article/figure/image?download&size=original&id=info:doi/10.1371/journal.pbio.2006352.g003>
Fig 3. DNA sequencing–based characterization of the microbiome of Sierra
Mixe maize.
(A) Samples clustered by PCoA on Bray-Curtis dissimilarity distance matrix.
Bacterial communities were assessed using PCR amplification and sequencing
of rRNA genes. Each point corresponds to an individual sample. Permanova
tests run using *adonis* in *vegan* revealed mucilage samples were
statistically distinct (e.g., mucilage versus rhizosphere *P* = 0.002,
mucilage versus roots *P* = 0.03, mucilage versus aerial roots *P* = 0.03).
(B) Metagenomic sequencing–based analysis of homologs of core *nif* genes (
*nifH*, *nifD*, *nifE*, *nifK*, *nifN*, and *nifB*) and alternate
nitrogenase (*anfG*/*vnfG*). Metagenomic samples were searched for homologs
by mapping reads on reference *nif* trees. The number of hits was
normalized to an estimate of the number of bacterial genes in the
metagenomic sample (measured using the number of hits to the RecA hidden
Markov model). *The lowest abundance of a core *nif* gene in mucilage and
rhizosphere libraries. **Only core *nif* gene hit in stem library. anfG and
vnfG alternate nitrogenase were observed only in mucilage library. PCoA,
principal component analysis.
https://doi.org/10.1371/journal.pbio.2006352.g003
To assess the possibility that mucilage harbored a diazotrophic microbial
community, the mucilage was tested for nitrogenase activity using ARAs [34
<http://journals.plos.org/plosbiology/article?id=10.1371/journal.pbio.2006352#pbio.2006352.ref034>]
and by incorporation of 15N2 gas. ARA was used to assess leaves, stems,
underground roots, aerial roots (with and without mucilage), and mucilage
collected from Sierra Mixe maize plants grown either in Sierra Mixe,
Mexico, or Madison, USA. No ARA activity was detected in underground roots,
leaves, stems, or even aerial roots before mucilage production (S4 Fig
<http://journals.plos.org/plosbiology/article?id=10.1371/journal.pbio.2006352#pbio.2006352.s004>).
In contrast, significant ARA activity was detected in aerial roots
harboring mucilage (S4 Fig
<http://journals.plos.org/plosbiology/article?id=10.1371/journal.pbio.2006352#pbio.2006352.s004>)
and in isolated mucilage from plants grown in either Sierra Mixe or Madison
(Fig 4A
<http://journals.plos.org/plosbiology/article?id=10.1371/journal.pbio.2006352#pbio-2006352-g004>).
The ARA activity in mucilage isolated from Sierra Mixe maize that was grown
in Madison suggests either that the Sierra Mixe maize seeds carry an
endogenous inoculum of nitrogen-fixing bacteria or that Sierra Mixe maize
can recruit adequate nitrogen-fixing bacteria from local environments.
Nitrogen fixation by mucilage samples was also measured by direct
incorporation of 15N2 in mucilage samples collected from Sierra Mixe maize (Fig
4B
<http://journals.plos.org/plosbiology/article?id=10.1371/journal.pbio.2006352#pbio-2006352-g004>
).
[image: thumbnail]
<http://journals.plos.org/plosbiology/article/figure/image?size=medium&id=info:doi/10.1371/journal.pbio.2006352.g004>
Download:
- PPT
<http://journals.plos.org/plosbiology/article/figure/powerpoint?id=info:doi/10.1371/journal.pbio.2006352.g004>
PowerPoint slide
<http://journals.plos.org/plosbiology/article/figure/powerpoint?id=info:doi/10.1371/journal.pbio.2006352.g004>
- PNG
<http://journals.plos.org/plosbiology/article/figure/image?download&size=large&id=info:doi/10.1371/journal.pbio.2006352.g004>
larger image
<http://journals.plos.org/plosbiology/article/figure/image?download&size=large&id=info:doi/10.1371/journal.pbio.2006352.g004>
- TIFF
<http://journals.plos.org/plosbiology/article/figure/image?download&size=original&id=info:doi/10.1371/journal.pbio.2006352.g004>
original image
<http://journals.plos.org/plosbiology/article/figure/image?download&size=original&id=info:doi/10.1371/journal.pbio.2006352.g004>
Fig 4. Nitrogenase and N2 fixation activity in mucilage produced by Sierra
Mixe maize.
(A) Mucilage of various Sierra Mixe maize lines collected in Sierra Mixe or
field-grown plants in Madison, USA, and of teosinte display strong
acetylene reduction activity. (-, no acetylene; +, 10% acetylene).
Asterisks indicate significant differences (**P* < 0.05; ***P* < 0.01,
Mann-Whitney test). (B) Nitrogen fixation in Sierra Mixe maize mucilage by
15N2 assimilation. Mucilage collected from Sierra Mixe maize grown in
Sierra Mixe was incubated in gas-tight vials filled with 15N2 or 14N2 gas
for 70 hours at 37 °C. 15N (atom % excess) was determined by IRMS. (C and
D) *H*. *seropedicae* and *A*. *brasilense* display acetylene reduction
activity when added to nonfixing mucilage, whereas the same mucilage
supplemented with sterile medium (-) or the same bacteria without mucilage
(-) do not. (E) Oxygen concentration at 8 mm inside of the mucilage. Means
and standard errors are shown. Different letters indicate statistically
supported groups (Kruskal-Wallis test). (Data at DOI:
10.6084/m9.figshare.6534545 <https://doi.org/10.6084/m9.figshare.6534545>).
IRMS, isotope-ratio mass spectrometry.
https://doi.org/10.1371/journal.pbio.2006352.g004
As with Sierra Mixe maize, a wild relative, *Z*. *mays* ssp. *mexicana*
(teosinte), also produced extensive aerial roots (S5 Fig
<http://journals.plos.org/plosbiology/article?id=10.1371/journal.pbio.2006352#pbio.2006352.s005>)
but much smaller amounts of secreted mucilage. To test the ability of the
teosinte mucilage to support nitrogen fixation, we collected mucilage from
several plants of teosinte and measured endogenous nitrogenase activity
using ARA. Acetylene reduction was readily observed in teosinte mucilage (Fig
4A
<http://journals.plos.org/plosbiology/article?id=10.1371/journal.pbio.2006352#pbio-2006352-g004>),
suggesting that production of mucilage that supports nitrogen fixation by
an associated nitrogen-fixing microbiota may be an ancient trait of maize
and potentially introgressed from *Z*. *mays* ssp. *mexicana* into the
Sierra Mixe landrace postdomestication.
To assess the mucilage characteristics that support nitrogen fixation, we
tested the ability of 2 phylogenetically distinct nitrogen-fixing bacteria
to reduce acetylene when inoculated in the mucilage collected from aerial
roots of Sierra Mixe maize. Before the experiment, the mucilage was frozen
for 2 weeks at –80 °C and thawed, which abolished endogenous nitrogenase
activity (Fig 4C
<http://journals.plos.org/plosbiology/article?id=10.1371/journal.pbio.2006352#pbio-2006352-g004>).
Two nitrogen-fixing bacteria, *H*. *seropedicae*, and *A*. *brasilense*,
showed readily detectable ARA activity when added to the mucilage (Fig 4C
and 4D
<http://journals.plos.org/plosbiology/article?id=10.1371/journal.pbio.2006352#pbio-2006352-g004>).
Bacterial nitrogenase is O2-sensitive and needs to be protected by a
low-oxygen (<5%) environment or physiological protective mechanisms, as
well as an abundant carbon source to derive energy for this process [35
<http://journals.plos.org/plosbiology/article?id=10.1371/journal.pbio.2006352#pbio.2006352.ref035>].
To determine if mucilage could fulfill these requirements, we measured the
free-oxygen concentration in the mucilage of Sierra Mixe maize and teosinte
at the depth of 8 mm and found it to be <5%, indicating that the mucilage
can provide a microaerobic environment compatible with nitrogen fixation
for these bacteria [36
<http://journals.plos.org/plosbiology/article?id=10.1371/journal.pbio.2006352#pbio.2006352.ref036>]
(Fig 4D
<http://journals.plos.org/plosbiology/article?id=10.1371/journal.pbio.2006352#pbio-2006352-g004>).
Mucilage is also comprised of complex sugars that may be catabolized to
provide free sugars—mainly arabinose, fucose, and galactose—capable of
supporting bacterial growth and nitrogen fixation. To determine whether
these properties of the mucilage are sufficient to support nitrogen
fixation, we created an artificial medium mimicking these mucilage
properties by using a low-N medium, solidified with 0.2% agar, that reduced
oxygen concentration to levels almost as low as those found in the mucilage
(S6A Fig
<http://journals.plos.org/plosbiology/article?id=10.1371/journal.pbio.2006352#pbio.2006352.s006>)
and supplemented with a mix of free sugars corresponding to the composition
of the fully hydrolyzed mucilage carbohydrates. *H*. *seropedicae*, *A*.
*brasilense*, and *Burkholderia unamae* (S6B, S6C and S6D Fig
<http://journals.plos.org/plosbiology/article?id=10.1371/journal.pbio.2006352#pbio.2006352.s006>)
showed significant ARA activity in this reconstructed mucilage, indicating
that the low O2 and free sugars provided by the aerial root mucilage are
sufficient to support nitrogen fixation by these diazotrophs.
Based on ARA, we can conclude that mucilage from Sierra Mixe maize harbors
native diazotrophs and can also support the N2-fixing activity of the
exogenously inoculated diazotrophs, *H*. *seropedicae*, *A*. *brasilense*,
and *B*. *unamae*. However, these data did not demonstrate that the aerial
roots had the capacity to take up and assimilate the fixed N. To test
whether atmospheric N2 that was fixed by mucilage-associated diazotrophs
could be transferred to and utilized by the Sierra Mixe maize, a more
direct 15N2 gas–enrichment experiment was used. Aerial roots, along with
their generated mucilage, inoculated with *A*. *brasilense* Sp7 exhibited
significant 15N2 gas incorporation in comparison to the 14N2 gas-treated
roots (Fig 5
<http://journals.plos.org/plosbiology/article?id=10.1371/journal.pbio.2006352#pbio-2006352-g005>),
and isotope-ratio mass spectrometry (IRMS) analysis confirmed significant
enrichment of 15N in chlorophyll (converted to pheophytin for analysis) of
these roots compared to the negative controls (Fig 5
<http://journals.plos.org/plosbiology/article?id=10.1371/journal.pbio.2006352#pbio-2006352-g005>
).
[image: thumbnail]
<http://journals.plos.org/plosbiology/article/figure/image?size=medium&id=info:doi/10.1371/journal.pbio.2006352.g005>
Download:
- PPT
<http://journals.plos.org/plosbiology/article/figure/powerpoint?id=info:doi/10.1371/journal.pbio.2006352.g005>
PowerPoint slide
<http://journals.plos.org/plosbiology/article/figure/powerpoint?id=info:doi/10.1371/journal.pbio.2006352.g005>
- PNG
<http://journals.plos.org/plosbiology/article/figure/image?download&size=large&id=info:doi/10.1371/journal.pbio.2006352.g005>
larger image
<http://journals.plos.org/plosbiology/article/figure/image?download&size=large&id=info:doi/10.1371/journal.pbio.2006352.g005>
- TIFF
<http://journals.plos.org/plosbiology/article/figure/image?download&size=original&id=info:doi/10.1371/journal.pbio.2006352.g005>
original image
<http://journals.plos.org/plosbiology/article/figure/image?download&size=original&id=info:doi/10.1371/journal.pbio.2006352.g005>
Fig 5. Analysis of Sierra Mixe maize samples for 15N2 enrichment in
mucilage, aerial roots, and pheophytin from aerial roots.
Mucilage was generated from aerial roots and inoculated with *A*.
*brasilense* Sp7. 15N2 gas was pumped in and, after incubation mucilage,
was separated from the aerial roots. Mucilage alone and aerial roots alone
were subjected to analysis by IRMS. Results revealed a significant
enrichment of 15N2 in mucilage alone and aerial roots alone (left y-axis).
Since the inoculated aerial roots may contain *A*. *brasilense* Sp7
attached to the surface, we extracted pheophytin from these aerial roots to
test 15N2 incorporation in pheophytin. Results revealed a significant
enrichment of 15N2 in these aerial roots, indicating that aerial roots are
indeed the sites for transfer of fixed nitrogen to the plants (right
y-axis). 14N2 samples were used as negative controls. *n* = 4 (aerial roots
and mucilage), *n* = 3 (pheophytin). The asterisk (*) indicates a
statistically significant difference (*p* < 0.05). (Data at DOI:
10.6084/m9.figshare.6534545 <https://doi.org/10.6084/m9.figshare.6534545>)
IRMS, isotope-ratio mass spectrometry.
https://doi.org/10.1371/journal.pbio.2006352.g005
Nitrogen fixation contributes to maize N nutrition
The transfer of 15N2 from mucilage to the aerial root tissue and
chlorophyll demonstrated the potential of this diazotrophic community to
contribute to the nitrogen nutrition of the plant, but a major question of
this study is whether the mucilage-associated diazotrophic microbiota
served to transfer fixed nitrogen to fulfill, at least in part, the reduced
nitrogen requirements of Sierra Mixe maize under field conditions. The
contribution of atmospheric nitrogen fixation to Sierra Mixe maize was
first estimated in the field using natural abundance 15N measurements [37
<http://journals.plos.org/plosbiology/article?id=10.1371/journal.pbio.2006352#pbio.2006352.ref037>
,38
<http://journals.plos.org/plosbiology/article?id=10.1371/journal.pbio.2006352#pbio.2006352.ref038>].
This method relies on the relative abundance of the stable isotope 15N in
the atmosphere and soil, with 15N abundance being more abundant in the soil
than in the air. As a consequence, plants that derive N from the atmosphere
will exhibit reduced δ15N levels when compared to reference nonfixing
plants. In 2006, samples of Sierra Mixe maize and reference plants from the
Asteraceae and Ranunculaceae (families with no known nitrogen-fixing
members) growing near each other were collected from each of 2 fields. In
this preliminary experiment, Sierra Mixe maize δ15N was significantly lower
than the reference plants, indicating the assimilation of atmospheric
nitrogen (S1 Table
<http://journals.plos.org/plosbiology/article?id=10.1371/journal.pbio.2006352#pbio.2006352.s008>).
In 2010, 2011, and 2012, the methods from [38
<http://journals.plos.org/plosbiology/article?id=10.1371/journal.pbio.2006352#pbio.2006352.ref038>
,39
<http://journals.plos.org/plosbiology/article?id=10.1371/journal.pbio.2006352#pbio.2006352.ref039>]
were used in experiments in Sierra Mixe by sampling reference species of
non-nitrogen-fixing plants growing near the Sierra Mixe maize plants and a
conventional maize variety, Maiz Blanco Conasupo. In addition to
determining δ15N from each maize and reference plant sample, leaf samples
of each reference plant were used for 18S rRNA sequence analysis to
identify the reference species (Table 1A
<http://journals.plos.org/plosbiology/article?id=10.1371/journal.pbio.2006352#pbio-2006352-t001>).
The δ15N values of Sierra Mixe maize grown in the field in Sierra Mixe were
determined at a single developmental time point in 2010 and at 5
developmental time points in 2011 and 2012. In 2010, the δ15N values for
the Sierra Mixe maize were significantly lower than those of the reference
plant species and of the conventional maize variety, Maiz Blanco
Conasupo (Table
1A
<http://journals.plos.org/plosbiology/article?id=10.1371/journal.pbio.2006352#pbio-2006352-t001>),
indicating that the Sierra Mixe maize was able to derive a significant part
of its tissue nitrogen from atmospheric dinitrogen. Similar δ15N values
from root and leaf samples also showed that the leaf samples analyzed were
representative of the whole plant (S2 Table
<http://journals.plos.org/plosbiology/article?id=10.1371/journal.pbio.2006352#pbio.2006352.s009>).
In 2011 and 2012, the δ15N values of Sierra Mixe maize were significantly
lower than the reference plants at 4 of the 5 developmental time points,
suggesting that Sierra Mixe maize derived a portion of its tissue nitrogen
from atmospheric nitrogen (Table 1B
<http://journals.plos.org/plosbiology/article?id=10.1371/journal.pbio.2006352#pbio-2006352-t001>).
The calculated percent of nitrogen derived from the atmosphere (%Ndfa) from
the δ15N values in Table 1
<http://journals.plos.org/plosbiology/article?id=10.1371/journal.pbio.2006352#pbio-2006352-t001>
ranged between 30% and 80% (S7 Fig
<http://journals.plos.org/plosbiology/article?id=10.1371/journal.pbio.2006352#pbio.2006352.s007>
).
[image: thumbnail]
<http://journals.plos.org/plosbiology/article/figure/image?size=medium&id=info:doi/10.1371/journal.pbio.2006352.t001>
Download:
- PPT
<http://journals.plos.org/plosbiology/article/figure/powerpoint?id=info:doi/10.1371/journal.pbio.2006352.t001>
PowerPoint slide
<http://journals.plos.org/plosbiology/article/figure/powerpoint?id=info:doi/10.1371/journal.pbio.2006352.t001>
- PNG
<http://journals.plos.org/plosbiology/article/figure/image?download&size=large&id=info:doi/10.1371/journal.pbio.2006352.t001>
larger image
<http://journals.plos.org/plosbiology/article/figure/image?download&size=large&id=info:doi/10.1371/journal.pbio.2006352.t001>
- TIFF
<http://journals.plos.org/plosbiology/article/figure/image?download&size=original&id=info:doi/10.1371/journal.pbio.2006352.t001>
original image
<http://journals.plos.org/plosbiology/article/figure/image?download&size=original&id=info:doi/10.1371/journal.pbio.2006352.t001>
Table 1. Natural abundance 15N determinations.
(A) δ15N values from Sierra Mixe maize, a conventional maize variety (Maiz
Blanco Conasupo), and reference plants grown in Sierra Mixe, 3 months after
planting. Values are given as mean and standard deviation. Statistical
comparisons were made between the means of the reference plants, Maiz
Blanco Conasupo, and *Z*. *mays* S. Mixe, using Student *t* tests (*p* <
0.05). Different letters indicate statistically supported groups. (B) δ15N
values from Sierra Mixe maize plants grown in Fields 1 and 2 in Sierra Mixe
during 2011 and 2012 at 2, 3, 4, 5, and 6 months after planting. Values are
given as mean and standard deviation. Statistical comparisons were made
between the reference plants mean and *Z*. *mays* S. Mixe means at each
time point using Student *t* tests (*p* < 0.05). Different letters indicate
statistically supported groups. Reference plants are listed in S3 Table
<http://journals.plos.org/plosbiology/article?id=10.1371/journal.pbio.2006352#pbio.2006352.s010>.
(Data at DOI: 10.6084/m9.figshare.6534545
<https://doi.org/10.6084/m9.figshare.6534545>).
https://doi.org/10.1371/journal.pbio.2006352.t001
The method of using natural abundance 15N and other species as reference
plants to calculate %Ndfa is potentially limiting because of differences in
root and shoot growth and phenology of reference and test plants and the
limited range of δ15N found in soils. An alternative method, 15N
enrichment, is similar to the natural abundance methods but enriches soil 15N
by the addition of 15N fertilizer, thereby increasing the difference
between soil and atmospheric δ15N and assay sensitivity. Several direct
comparisons have indicated that both methods can give comparable but
slightly different results [38
<http://journals.plos.org/plosbiology/article?id=10.1371/journal.pbio.2006352#pbio.2006352.ref038>
,40
<http://journals.plos.org/plosbiology/article?id=10.1371/journal.pbio.2006352#pbio.2006352.ref040>
].
Another method of estimating N2 fixation is the “N Difference” method,
which determines the difference between the total N content of an N2-fixing
plant and the total N content of a reference nonfixing plant. Total N is
calculated by multiplying total N content (%) in a specific plant sample
and the total biomass (kg/ha or kg) produced by the plant. The %Ndiff is
calculated as described in Materials and methods.
In 2016 and 2017, we assessed atmospheric nitrogen fixation using the
15N-isotope-enrichment
method (1%–10% enrichment) at 3 vegetative growth stages—V9, V12, and
Tassel—[41
<http://journals.plos.org/plosbiology/article?id=10.1371/journal.pbio.2006352#pbio.2006352.ref041>]
in a random complete block design (5 replicates) in 3 low-N Sierra Mixe
fields and at Tassel stage in 2017 in the same fields using the same design
(Table 2
<http://journals.plos.org/plosbiology/article?id=10.1371/journal.pbio.2006352#pbio-2006352-t002>).
Field 3 (with a history of 0–1 year of maize production) yielded
significant differences in Atom% 15N only for SM2 at the Tassel stage in
2016, but shoot N was significantly different in both 2016 and 2017. In
2016, Sierra Mixe maize landrace varieties exhibited significantly lower
Atom%15N levels than the reference plants in Field 4, (with a history of
1–2 years of maize production) at Tassel and at V9 in 2016, and at Tassel
in both years for shoot N. In both 2016 and 2017, Sierra Mixe maize
landraces in Field 5 (over 3 years of continuous maize production)
exhibited significantly lower Atom%15N and shoot N at all stages sampled,
indicating a significant level of atmospheric nitrogen fixation in those
experiments. The calculated %Ndfa ranged between 31% and 55%, and Ndiff
ranged from 29%–82%. The correlation between Ndfa and Ndiff was 0.55 and
0.44 (*P* < 0.01) across locations in 2016 and 2017, respectively.
Significant measures of N2 fixation were detected in 4 of 6 experiments by
Atom% δ15N N determinations (Ndfa) and in 6 of 6 experiments by Ndiff
determinations. Root and shoots exhibited significant differences in
biomass, height, and stem diameter between control hybrids and local
landraces (S4 Table
<http://journals.plos.org/plosbiology/article?id=10.1371/journal.pbio.2006352#pbio.2006352.s011>).
Soil analyses (S5 Table
<http://journals.plos.org/plosbiology/article?id=10.1371/journal.pbio.2006352#pbio.2006352.s012>)
showed that all sites were depleted in soil nitrogen yet produced a crop
greater than 2,000 kg/ha. It is possible that differences between
microbiota associated with the 3 fields in different stages of crop
rotation (0 to >4 years of continuous maize production) account for
differences observed among fields and between years, but further research
is needed to answer this question.
[image: thumbnail]
<http://journals.plos.org/plosbiology/article/figure/image?size=medium&id=info:doi/10.1371/journal.pbio.2006352.t002>
Download:
- PPT
<http://journals.plos.org/plosbiology/article/figure/powerpoint?id=info:doi/10.1371/journal.pbio.2006352.t002>
PowerPoint slide
<http://journals.plos.org/plosbiology/article/figure/powerpoint?id=info:doi/10.1371/journal.pbio.2006352.t002>
- PNG
<http://journals.plos.org/plosbiology/article/figure/image?download&size=large&id=info:doi/10.1371/journal.pbio.2006352.t002>
larger image
<http://journals.plos.org/plosbiology/article/figure/image?download&size=large&id=info:doi/10.1371/journal.pbio.2006352.t002>
- TIFF
<http://journals.plos.org/plosbiology/article/figure/image?download&size=original&id=info:doi/10.1371/journal.pbio.2006352.t002>
original image
<http://journals.plos.org/plosbiology/article/figure/image?download&size=original&id=info:doi/10.1371/journal.pbio.2006352.t002>
Table 2. 15N-isotope-enrichment determinations in field trials.
Percent Ndfa and Ndiff were calculated for Sierra Mixe varieties when Atom%
15N excess or Shoot N for the whole plant were significantly different from
reference varieties as assessed by ANOVA and single-degree-of-freedom
contrasts (*p* = 0.05), respectively. Values followed by asterisks are
significantly different from the reference varieties based on
single-degree-of-freedom contrasts (*p* < 0.05). Percent Ndfa and Ndiff
were not calculated for reference (dashes). (Data at DOI:
10.6084/m9.figshare.6534545 <https://doi.org/10.6084/m9.figshare.6534545>).
https://doi.org/10.1371/journal.pbio.2006352.t002
Discussion
We have demonstrated that the mucilage associated with the aerial roots of
Sierra Mixe maize can support a complex diazotrophic microbiota enriched
for homologs of genes encoding nitrogenase subunits that harbor active
nitrogenase activity, and that nitrogen is transferred efficiently from the
nitrogen-fixing bacteria to the host plant tissues. Collectively, over
several years and locations, the 15N natural abundance and 15N enrichment
results of 2 selections of a Sierra Mixe indigenous maize landrace suggest
that its nitrogen nutrition when grown in its native environment is
partially fulfilled by fixation of atmospheric nitrogen. Nitrogen fixation
is a particularly difficult phenotype to evaluate, as all the techniques
available are prone to artifacts and can give different estimates for
nitrogen fixation [42
<http://journals.plos.org/plosbiology/article?id=10.1371/journal.pbio.2006352#pbio.2006352.ref042>
,43
<http://journals.plos.org/plosbiology/article?id=10.1371/journal.pbio.2006352#pbio.2006352.ref043>].
In this study, we used several classical techniques with Sierra Mixe maize
and have shown over multiple locations and years that Sierra Mixe maize can
fix nitrogen at rates (29%–82%) not previously reported, to our knowledge,
in maize.
This study also revealed a new and important function for aerial roots and
the mucilage they produce besides preventing lodging or water uptake [30
<http://journals.plos.org/plosbiology/article?id=10.1371/journal.pbio.2006352#pbio.2006352.ref030>].
This role in nitrogen fixation is probably the most important one for
aerial roots that do not reach the ground. It will be interesting to
explore if aerial roots produced by other cereals such as sorghum can
perform a similar function [44
<http://journals.plos.org/plosbiology/article?id=10.1371/journal.pbio.2006352#pbio.2006352.ref044>].
We cannot rule out that diazotrophic activity in other parts of Sierra Mixe
maize may also contribute to the acquisition of reduced nitrogen from the
atmosphere. The developmental timing of the appearance of fixed atmospheric
N2 in Sierra Mixe maize plants (Tables 1
<http://journals.plos.org/plosbiology/article?id=10.1371/journal.pbio.2006352#pbio-2006352-t001>
and 2
<http://journals.plos.org/plosbiology/article?id=10.1371/journal.pbio.2006352#pbio-2006352-t002>)
before the extensive development of aerial roots suggests that there may,
indeed, be additional sites of nitrogen fixation. However, we have not
detected any significant nitrogenase activity outside of the aerial root
mucilage.
The genetic basis of the trait or the source of the microbial inoculum,
which may be either environmental or seed-borne, are unresolved. The
observation that a teosinte species (*Z*. *mays* ssp. *mexicana*) also
exhibits a similar diazotrophic activity in aerial root–associated mucilage
suggests that this is an ancient trait that may have been introgressed and
amplified in the Sierra Mixe landrace. It will be important, in the future,
to determine the genetic basis of the trait, the identity of associated
microbial diazotrophs, and the mechanisms of microbial recruitment. This
research, together with other published research [5
<http://journals.plos.org/plosbiology/article?id=10.1371/journal.pbio.2006352#pbio.2006352.ref005>
,18
<http://journals.plos.org/plosbiology/article?id=10.1371/journal.pbio.2006352#pbio.2006352.ref018>
,23
<http://journals.plos.org/plosbiology/article?id=10.1371/journal.pbio.2006352#pbio.2006352.ref023>],
suggests new avenues for research into potentially novel mechanisms of
biological N2 fixation in maize. This could have a significant impact on
maize crop productivity and nitrogen use efficiency, particularly in
regions of the world where agriculture is characterized by poor soil
nutrition.
Materials and methods
Plant material
Sierra Mixe maize seeds were obtained in Sierra Mixe region of Oaxaca,
Mexico, from an open pollinated population. *Z*. *mays* ssp. *mexicana*
(teosinte), LH123HT, Mo17, PHG39, LH82, PH207, and B73 seeds were obtained
from USDA National Plant Germplasm System (NPGS) (accessions Ames 8083,
PI601079, PI558532, PI600981, PI601170, PI601005, and PI550473,
respectively). Maize line Hickory King was obtained from Victory Seeds
(accession 3140041). Tornado-F21 and H-377 were obtained from Semillas
Ceres in Oaxaca. SM1 and SM2 are different selections from the Sierra Mixe
landrace. SM1 is a uniform population based on kernel size, shape, and
color, and SM2 is a heterogeneous population representing the landrace.
Biological materials were accessed and utilized under an Access and Benefit
Sharing Agreement between the Sierra Mixe community and BioN2, Inc., and
with permission from the Mexican government. An internationally recognized
certificate of compliance under the Nagoya Protocol
(ABSCH-IRCC-MX-207343-3) has been issued for such activities.
Bacterial strains and media
*A*. *brasilense* Sp7 and *B*. *unamae* MTI-641 were kindly provided by Dr.
G. Alexandre (University of Tennessee, Knoxville, USA) and Dr. A. Hirsch
(University of California, Los Angeles, USA), respectively. *H*.
*seropedicae* Z152 (ATCC 35894) was provided by the ATCC (
http://www.atcc.org/). Bacteria were grown in liquid BSE medium.
Sample collection
The rhizosphere and plant tissues that include stem, leaf, aerial roots,
underground roots, and mucilage of Sierra Mixe maize were sampled during
seasons 2010, 2011, and 2012 from Fields 1 and 2 in Sierra Mixe. For plant
endophyte analysis, tissues were surface sterilized by rinsing with mqH2O,
shaken gently in 70% ethanol for 5 minutes, placed into 1% hypochlorite
bleach, gently stirred for 10 minutes, rinsed 3 times in mqH20, and dried
in a laminar flow cabinet. Roots and stems were also dissected to remove
epidermal tissues before extraction. For seed endophyte analysis, embryo
and endosperm of Sierra Mixe, Hickory King, and B73 were withdrawn from the
seeds by hand using a razor blade in a laminar flow cabinet and were
collected in 1.5 ml sterile microcentrifuge tubes. For this study, the
rhizosphere was defined as a layer of soil covering the outer surface of
the root system that could be washed from roots in a buffer/detergent
solution. Roots were first separated and shaken to remove loosely adhering
soil. All soils and plant material samples were used immediately for DNA
extraction. Soil fertility analysis, which included physical parameters,
soil reaction, and salinity, was performed in AgroLab (Pachuma, Mexico).
Plant phenotyping
The number of nodes with aerial roots was monitored weekly (greenhouse) or
after 14 weeks (field). The total number of aerial roots was quantified
after 14 weeks. The disappearance of leaf wax and appearance of trichomes
were monitored weekly to determine the transition between juvenile stage
and adult stage in Sierra Mixe and Hickory King maize.
Greenhouse and field experiments, Madison, USA
For experiments in the greenhouse, seeds of Sierra Mixe of Fields 1 and 2
and Hickory King were surface sterilized and germinated as described
previously. After 1 week, the seedlings are transplanted in 40-liter pots
filled with a mix of sand and perlite (v:v) and grown in a high-ceiling
greenhouse at the Biotron facility (University of Wisconsin, Madison, USA).
Plants were watered twice a day for 2 minutes with half-strength of
Hoagland solution. For experiments in the field, 3 independent plots of 20
plants per genotype were planted, with 3 border rows (B73) between each
genotype. Sierra Mixe and Teosinte plants that were grown in Madison for
the ARA were planted in the same field at the same time. This experiment
was replicated in 3 different field plots.
Mucilage glycosyl composition
Glycosyl composition analysis was performed by combined gas
chromatography/mass spectrometry (GC/MS) of the per-*O*-trimethylsilyl
(TMS) derivatives of the monosaccharide methyl glycosides produced from the
sample by acidic methanolysis. Methyl glycosides were first prepared from
dry mucilage samples by methanolysis in 1 M HCl in methanol at 80 °C (18–22
hours), followed by re-*N*-acetylation with pyridine and acetic anhydride
in methanol (for detection of amino sugars). The samples were then
per-*O*-trimethylsilylated
by treatment with Tri-Sil (Pierce) at 80 °C (0.5 hours). GC/MS analysis of
the TMS methyl glycosides was performed on an HP 6890 GC interfaced to a
5975b MSD, using an All Tech EC-1 fused silica capillary column (30 m ×
0.25 mm ID). The analysis was performed at the Complex Carbohydrate Center
Research Center (CCRC) of University of Georgia, Athens, USA.
DNA extraction
DNA (80–150 ng μl−1) was extracted from 100 mg of the rhizosphere plant
tissues using a DNA isolation kit (Mo Bio Laboratories, Carlsbad, USA). The
PCR control for microbial DNA isolation was performed on 16S rRNA genes.
PCR was performed using eubacterial primers 27F
(5′-AGAGTTTGATCCTGGCTCAG-3′) and 1492R (5′-GGTTACCTTGTTACGACTT-3′), and the
product was approximately a 1,450 bp fragment. Amplification was carried
out with 1 μM of each primer in 3 mM MgCl2, 20 μM of each dNTP, 1.25 units
of *Taq* polymerase (Promega) in a total volume of 20 μl of 1X reaction
buffer (Promega, Madison, USA). PCR conditions included an initial
denaturation at 95 °C for 3 minutes followed by 35 cycles of denaturation
at 94 °C for 1 minute, annealing at 56 °C for 1 minute, and elongation at
72 °C for 1.5 minutes, with a final elongation at 72 °C for 7 minutes. DNA
was resolved using an agarose gel run at 100 V for 30 minutes for analysis
of total DNA and amplification of PCR products, respectively. Gels were
visualized by ethidium bromide staining under UV light in a gel
documentation system. The products obtained were purified with a NucleoSpin
Gel extraction kit (Clontech, Palo Alto, USA).
Illumina-based 16S rRNA gene sequencing
16S rRNA gene PCR and sequencing of rhizosphere and plant tissues were
carried out using the Caporaso protocol [45
<http://journals.plos.org/plosbiology/article?id=10.1371/journal.pbio.2006352#pbio.2006352.ref045>].
We extended the Caporaso approach [46
<http://journals.plos.org/plosbiology/article?id=10.1371/journal.pbio.2006352#pbio.2006352.ref046>]
to a dual barcode scheme for each sample and replaced the Golay barcodes
with a different set of Illumina-compatible barcodes that were designed to
balance base composition and tolerate up to 4 sequencing errors in barcode
sequences. The forward primer used was
AATGATACGGCGACCACCGAGATCTACAC[Barcode]TATGGTAATTGTGTGCCAGCMGCCGCGGTAA, and
the reverse primer was
CAAGCAGAAGACGGCATACGAGAT[Barcode]AGTCAGTCAGCCGGACTACHVGGGTWTCTAAT. The
barcodes used were designed to allow pooling of multiple samples within a
single MiSeq run. Ten cycles of PCR with barcoded primers were performed at
low annealing temperature (55 °C); samples were then pooled and cleaned
using a Qiagen column to remove the unincorporated primers. At this stage,
an additional 10 or 20 cycles of PCR were performed on the pool using the
Illumina paired-end flowcell primers with a higher annealing temperature
(65 °C). The resulting PCR product was subjected to QC with an Agilent
Bioanalyzer and estimated concentration using KAPA Biosystems qPCR kit. The
samples were diluted to the appropriate loading concentration for a MiSeq
run, spiked with 25% phiX control library, and sequenced using an Illumina
MiSeq instrument with the manufacturer’s standard 150 nucleotides
paired-end dual-index sequencing protocol and the custom sequencing primers.
The Illumina sequences were obtained from 2 MiSeq runs (2X150 bp
paired-end) and were demultiplexed using a custom script (
https://figshare.com/s/04997ae7f7d18b53174a). The 822,804 reads thus
obtained were trimmed to a Phred-equivalent of 20 and filtered for adaptor
contamination using BBDuk (of the BBTool packages
https://sourceforge.net/projects/bbmap/). Because of the low quality of the
reverse mate pair, reads of the forward mate were used in the analysis. The
reads were then preprocessed and analyzed using DADA2 [47
<http://journals.plos.org/plosbiology/article?id=10.1371/journal.pbio.2006352#pbio.2006352.ref047>].
Prescribed standard filtering parameters were used, such as PhiX
contamination check and removal of reads with more than 2 errors or
ambiguous bases or with an expected error greater than 2. Chimeras were
identified and removed using the removeBimeraDenovo function of DADA2. The
clean reads were then collapsed into sequence variants and classified using
RDP training set (version 14). The sequence variants that were classified
as chloroplast or mitochondria were removed from further analyses. From
samples with library size ranging from 84 to 20,597 reads (mean of 4,703),
995 unique sequence variants were identified.
Alpha and Beta diversity metrics were generated using the Phyloseq 3.4.2 R
packages [48
<http://journals.plos.org/plosbiology/article?id=10.1371/journal.pbio.2006352#pbio.2006352.ref048>].
Alpha diversity was calculated using Shannon and Simpson indices.
Additionally, a PCoA plot based upon Bray-Curtis dissimilarity matrix was
used to visualize the differences in samples. The sequence variant table
was used to generate a heat map following the variance-stabilizing
transformation in DESeq2 [49
<http://journals.plos.org/plosbiology/article?id=10.1371/journal.pbio.2006352#pbio.2006352.ref049>].
Permanova tests were run using the *adonis* function from the *vegan*
3.4.3.R package (https://CRAN.R-project.org/package=vegan) performed on the
NMDS ordination.
Metagenomic sequencing
Illumina sequencing libraries from the same DNA extractions as above were
made using an adaptation of the Nextera transposase-based library
construction method with multiplex barcoding. Samples were then sequenced
on the MiSeq and HiSeq instruments. Illumina sequences thus obtained were
demultiplexed and trimmed using Trimmomatic (ver 0.33) [50
<http://journals.plos.org/plosbiology/article?id=10.1371/journal.pbio.2006352#pbio.2006352.ref050>]
with the following parameter: Illuminaclip 2:30:10, Headcrop:15,
Leading:20, Trailing:20, Sliding window:4:20, and Minlen:100. The reads
were then screened for PhiX and maize sequences (genomic, chloroplast, and
mitochondrial) using Bowtie2 aligner [51
<http://journals.plos.org/plosbiology/article?id=10.1371/journal.pbio.2006352#pbio.2006352.ref051>]
against the PhiX genome (Genbank acc# NC_001422.1) and *Z*. *mays* cultivar
B73 draft genome (RefSeq assembly acc# GCF_000005005.2). The clean reads
were assigned taxonomy using Kaiju [52
<http://journals.plos.org/plosbiology/article?id=10.1371/journal.pbio.2006352#pbio.2006352.ref052>]
with the nr database. To calculate the beta diversity of the samples, we
used Phylosift (ver 1.0.1) [53
<http://journals.plos.org/plosbiology/article?id=10.1371/journal.pbio.2006352#pbio.2006352.ref053>],
which identifies and places reads matching 37 conserved phylogenetic marker
genes on a reference tree. From these placements, an Edge-PCA analysis [54
<http://journals.plos.org/plosbiology/article?id=10.1371/journal.pbio.2006352#pbio.2006352.ref054>]
was carried using Guppy [54
<http://journals.plos.org/plosbiology/article?id=10.1371/journal.pbio.2006352#pbio.2006352.ref054>
].
*Nif* gene search
Peptide sequences of the 6 core *nif* genes (*nifH*, *nifD*, *nifE*, *nifK*,
*nifN*, *nifB*) and alternate nitrogenase (*anfG*, *vnfG*) from known
diazotrophs as previously published [33
<http://journals.plos.org/plosbiology/article?id=10.1371/journal.pbio.2006352#pbio.2006352.ref033>]
were retrieved from GenPept as a reference. A multiple-sequence alignment
of these sequences was generated as a reference alignment using ClustalW2 [
55
<http://journals.plos.org/plosbiology/article?id=10.1371/journal.pbio.2006352#pbio.2006352.ref055>].
A blast search (E-value < 0.001) of 6 frame-translated metagenomic reads
was conducted against these reference sequences. The hits were then aligned
against the multiple sequences alignment of reference using clustal-Omega [
56
<http://journals.plos.org/plosbiology/article?id=10.1371/journal.pbio.2006352#pbio.2006352.ref056>]
followed by generation of phylogenetic trees for every individual *nif*
gene, using Fasttree2.1 [57
<http://journals.plos.org/plosbiology/article?id=10.1371/journal.pbio.2006352#pbio.2006352.ref057>]
with a WAG model of amino acid evolution and gamma20 likelihood. The reads
were assigned as belonging to the *nif* genes if they were inside the clade
of the reference sequences. Each read that had significant similarity to
one of the core *nif* genes was further analyzed by phylogenetic analysis
to confirm its assignment as one of the 6 core *nif* genes. The counts of
nif genes thus obtained were normalized by *recA* counts (determined using
*recA* TIGRFAM HMM [58
<http://journals.plos.org/plosbiology/article?id=10.1371/journal.pbio.2006352#pbio.2006352.ref058>]
with HMMER3 and an E-value cutoff of e−10).
Acetylene Reduction Assay ARA
For ARA with the mucilage, 2 ml of freshly collected mucilage from 1 or 2
aerial roots (Sierra Mixe) or several plants (teosinte) grown in the field
were introduced in 14.5 ml vials (Wheaton, Millville, USA) that were
tightly closed. For ARA with added bacteria, *A*. *brasilense*, *H*.
*seropedicae*, and *B*. *unamae* were grown in BSE medium for 48 hours.
Then, bacteria were collected by centrifugation (5 minutes, 4,000 × *g*)
and suspended in the Fahraeus medium. The 14.5 ml vials, each containing 5
ml of mucilage previously stored for several months at –20 °C to reduce
endogenous nitrogen-fixing bacteria, were inoculated with the bacterial
suspension at a final OD600nm = 0.01. Control tubes were prepared either
without bacteria or with 5 ml of Fahraeus medium instead of mucilage. Then,
850 μl of acetylene (Airgas) was injected into each vial. OD600nm was
measured for each tube after 72 hours. For both conditions, controls
without acetylene were performed in parallel. For ARA with aerial roots, 1
aerial root without mucilage was introduced in each 14.5 ml vial (10
replicates). One ml of acetylene (Airgas) was injected into each vial. For
ARA with seedlings, Sierra Mixe seedlings were inoculated with *A*.
*brasilense* and grown for 3 weeks. Plants were then transferred to 500 ml
jars, and 50 ml of acetylene was injected in each jar. For ARA with
underground roots, pieces of roots (about 10 cm long) were collected from
plants grown in pots and introduced into 14.5 ml vials (3 replicates).
Ethylene quantification was made by injecting 1 ml of the air phase,
sampled after 72 hours, on a gas chromatography (GC-2010 Shimadzu) equipped
with a Rt-Alumina BOND/KCL column (Restek).
Mucilage 15N2 assimilation
The enrichment of mucilage in 15N atom was achieved by removing 4 ml of
headspace gas and replacing it with 4 ml of either 15N2 (Sigma-Aldrich) or
14N2 nitrogen gas directly into a vial containing 1.0 mL of mucilage.
Mucilage was collected from Sierra Mixe maize plants grown in Sierra Mixe
and stored at 4 °C for up to 2 weeks between sampling and the determination
of 15N2 assimilation. The mucilage samples were incubated at 37 °C for 0
and 70 hours in the presence of 15N2. 15N2 assimilation was stopped by
freezing the mucilage samples at −20 °C. The samples were then freeze-dried
and weighed. The 15N2 analysis in the mucilage samples was performed at the
UC Davis Stable Isotope Facility (Davis, USA) and the UW-Madison Soil
Science Facility (Madison, USA). Statistical analysis was performed using
SYSTAT version 10 (Chicago, USA).
Measurement of free-oxygen concentration
For measurement in collected mucilage, 2 ml of mucilage was introduced in a
15 ml tube. The probe (robust oxygen mini probe, Pyroscience) was
introduced 8 mm deep in the mucilage and oxygen measurements performed
until stabilization of the signal was observed. Control corresponds to
free-oxygen concentration in the liquid Fahraeus medium. One-point
calibration was made in aerated water, as advised by the manufacturer.
15N2 gas–enrichment experiments
Aerial roots were collected from Sierra Mixe maize grown at the Biotron
greenhouse facility (University of Wisconsin, Madison, USA). Mucilage was
generated from each of these aerial roots by incubating them in 5 ml of
water at room temperature for 48 hours. Mucilage, along with the aerial
roots, was inoculated with *A*. *brasilense* Sp7. Then, 10%–15% (v/v) of 15N
2 gas was pumped into the vials, and the samples were incubated at 30 °C
for 48 hours. After incubation of mucilage alone, or aerial roots alone,
pheophytin extracted from these aerial roots was subjected to IRMS
analysis. To obtain pheophytin, chlorophyll was extracted from aerial roots
and converted to pheophytin by acid treatment, following as described [59
<http://journals.plos.org/plosbiology/article?id=10.1371/journal.pbio.2006352#pbio.2006352.ref059>].
14N2-treated mucilage and aerial roots were used as negative controls.
15N natural abundance
The proportion (%) of nitrogen derived from biological nitrogen fixation
(%Ndfa) was estimated from the 15N natural abundance (expressed in delta
units, ‰) of the Sierra Mixe maize (δ15Nfixing plant) and that of the
reference plant species (δ15Nref). In each of the 2011 and 2012 field
seasons in Sierra Mixe, 90–114 individual maize samples (depending on the
year) and 270 reference plant samples, representing 8–10 species (depending
on the year) of non-nitrogen-fixing plants, were analyzed. For the single
time point in 2010, 12 individual maize samples and 33 reference plant
samples, representing 8 species of non-nitrogen-fixing plants, were
analyzed. The reference plant species in the field were identified using
universal 18S PCR analysis from DNA sampled using FTA Plant Saver card (GE
Life Sciences, Pittsburg, USA) simultaneously with tissue samples collected
for 15N analysis. PCRs were performed using Sigma’s Extract-N-Amp Plant PCR
Kit according to the manufacturer for sequencing and BLASTN comparison. For
15N natural abundance, the third-youngest leaf of Sierra Mixe maize or
reference plants was collected from Field 3 and 4 from the second to the
sixth month postplanting and analyzed for N-isotope composition. Total
organic nitrogen was determined by Kjeldahl digestion followed by steam
distillation. Analysis for natural 15N abundance was carried out as
described by Bremer and van Kessel [38
<http://journals.plos.org/plosbiology/article?id=10.1371/journal.pbio.2006352#pbio.2006352.ref038>].
The 15N analysis was performed at UCD Stable Isotope Facility (
http://stableisotopefacility.ucdavis.edu/13cand15n.html). The percentage of
nitrogen derived from nitrogen fixation (%Ndfa) was calculated as
follows: where
“δ15N” is stable nitrogen isotopes, “ref” is the value from non-N-fixing
reference plants, “fixing plant” is Sierra Mixe maize, and “B” is the 15N
abundance in the air, assumed to be 0.0‰.
15N-enrichment field experiments
In 2016, 3 locations were chosen: Field 3, land that had not been planted
to crops for over 10 years; Field 4, land that had maize for 1 year; and
Field 5, land with continuous maize. A randomized complete block design
trial was established at each site, with 5 replicates with 4 varieties.
Each plot consisted of 6 matas surrounded by a common border of SM2 on all
sides and a double border on outside rows. A mata is the traditional
planting design in the Sierra Mixe region, similar to a hill plot in which
multiple plants are seeded together. Each mata was planted with 5 seeds and
thinned to 3 seeds for 18 plants per plot. Matas were planted in a grid 80
× 100 cm from each other. 15N was applied at a dose of 0.36 grams per plot
in a liquid solution, reaching the desired enrichment of 1% for all 3
fields, with 50 ml added per mata.
In 2017, the same 3 locations were planted with same design and entries,
except Field 3 consisted only of H377 and SM2 entries. In all 3 fields, 15N
was applied at a dose of 0.95 grams per plot, reaching the desired
enrichment of greater than 1%. A solution was spread evenly over each plot
using a garden watering can, such that the whole experimental area received
an equal amount of enriched 15N. Plants were covered with plastic bags at
the time of application (V5) to ensure that 15N was not directly applied to
the leaves and that the 15N was uniformly available to all plants.
Soil samples were taken from a 0–60 cm depth in each plot, blended, and
sent for analysis at UC Davis Soil lab. Means were calculated across
locations. In 2016, at V9 and V12, 1 mata (3 plants) was sampled; and at
Tassel, 4 matas (12 plants) were sampled. In 2017, a single sampling of 6
matas (18 plants) was sampled at Tassel. For each sampling, plants were dug
out to include all roots. Because of the high rainfall (2,100 mm
concentrated in the growing season from June to October), roots were
shallow for both reference and test varieties. Each plant was photographed,
and data were recorded for the number of plants, plant height, the total
fresh weight of shoots, and roots and stem diameter. Whole plants were
chopped, ground, subsampled, and dried in an oven to record total dry
weight for shoots and roots. Well-blended subsamples were taken and shipped
to Davis to measure Total N and 15N. Total nitrogen and Atom% 15N were
determined for each plot at each time point for the shoot. Total organic
nitrogen was determined by Kjeldahl digestion followed by steam
distillation. The 15N analysis was performed at UCD Stable Isotope Facility
(http://stableisotopefacility.ucdavis.edu/13cand15n.html).
%Ndfa was calculated using the 15N-enrichment method [40
<http://journals.plos.org/plosbiology/article?id=10.1371/journal.pbio.2006352#pbio.2006352.ref040>]
as Atom% excess is calculated with sample value obtained from the UC Davis
Stable Isotope Facility– 0.37 (n in air).
Nitrogen difference (%*NDiff*) method was calculated as
The average of Tornado F21 and H377 was used as the reference to calculate
%Ndfa and %Ndiff. For Ndiff calculations, the area harvested was adjusted
based on matas harvested at each time point.
Field data analyses
Data were analyzed using the R lme4 package. Data were checked for outliers
and subjected to ANOVA and mean separation using Least Significant
Difference (*p* = 0.05) for each location. LSDs were calculated only when
ANOVA F-tests were significant at *p* = 0.05. For %Ndfa and %Ndiff,
single-degree-of-freedom contrasts were calculated to compare test
varieties to the mean of the reference varieties (*P* > 0.05). Pearson
correlation coefficients were calculated between %Ndfa and %Ndiff.
Supporting information
pbio.2006352.s001.eps
sorry, we can't preview this file
fig*share*
<https://figshare.com/articles/Nitrogen_fixation_in_a_landrace_of_maize_is_supported_by_a_mucilage-associated_diazotrophic_microbiota/6941555>
*1 / 12*
Box plot indicating the alpha diversity as calculated by Phyloseq using (A)
Simpson index and (B) Shannon index.
(EPS)
S1 Fig.
<http://journals.plos.org/plosbiology/article/file?type=supplementary&id=info:doi/10.1371/journal.pbio.2006352.s001>Box
plot indicating the alpha diversity as calculated by Phyloseq using (A)
Simpson index and (B) Shannon index.
https://doi.org/10.1371/journal.pbio.2006352.s001
(EPS)
S2 Fig.
<http://journals.plos.org/plosbiology/article/file?type=supplementary&id=info:doi/10.1371/journal.pbio.2006352.s002>Taxonomic
distribution at the family level of the 25 most abundant bacterial families
in (A) rRNA gene libraries and (B) whole-genome shotgun libraries.
https://doi.org/10.1371/journal.pbio.2006352.s002
(EPS)
S3 Fig.
<http://journals.plos.org/plosbiology/article/file?type=supplementary&id=info:doi/10.1371/journal.pbio.2006352.s003>Heat
map showing the hierarchal complete linkage clustering of samples.
The heat map depicts the abundances of (A) 1,000 most abundant SVs and (B)
20 most abundant SVs in the dataset that were transformed using
variance-stabilizing transformation in DESeq2. The libraries are Mucilage
(Blue; OLMC00, OLMD00, OLMV00, OLMX00), Aerial Root (Gray; OLAR00, OLAR02,
OLAR04, OLAR05), Aerial Root with Mucilage (Pink; OLAR01, OLAR03), Stem
(Green; OLST00, OLST01, OLST02, OLST03), Underground Root (Brown; OLUR01,
OLUR02, OLUR03), and Rhizosphere (Magenta; OXRZ11, OXRZ12, OXRZ13, OXRZ21,
OXRZ22, OXRZ23, OXRZ32, OXRZ31, OXRZ33).
https://doi.org/10.1371/journal.pbio.2006352.s003
(EPS)
S4 Fig.
<http://journals.plos.org/plosbiology/article/file?type=supplementary&id=info:doi/10.1371/journal.pbio.2006352.s004>Nitrogenase
(acetylene reduction) activity in different organs of Sierra Mixe maize.
Significant nitrogenase activity was only found on aerial roots with
mucilage.
https://doi.org/10.1371/journal.pbio.2006352.s004
(EPS)
S5 Fig.
<http://journals.plos.org/plosbiology/article/file?type=supplementary&id=info:doi/10.1371/journal.pbio.2006352.s005>Aerial
root development in teosinte, Sierra Mixe maize, and a conventional
variety, Hickory King grown in the field in Madison, USA.
(A) Number of nodes with aerial roots and (B) number of aerial roots
observed on teosinte, Sierra Mixe maize, and Hickory King after 14 weeks.
Bar = standard error of the mean. Different letters indicate statistically
supported groups according to the Kruskal-Wallis test.
https://doi.org/10.1371/journal.pbio.2006352.s005
(EPS)
S6 Fig.
<http://journals.plos.org/plosbiology/article/file?type=supplementary&id=info:doi/10.1371/journal.pbio.2006352.s006>Effect
of reconstituted mucilage on oxygen diffusion and acetylene reduction.
(A) Oxygen measured at 3 depths in Fahraeus medium with (black bars) or
without (gray bars) 0.2% agar. (B) Effect of the different sugars present
in the mucilage on the ability of *H*. *seropedicae*, (C) *A*. *brasilense*,
and (D) *B*. *unamae* to reduce acetylene.
https://doi.org/10.1371/journal.pbio.2006352.s006
(EPS)
S7 Fig.
<http://journals.plos.org/plosbiology/article/file?type=supplementary&id=info:doi/10.1371/journal.pbio.2006352.s007>Proportion
of nitrogen derived from biological N2 fixation (%Ndfa) in Sierra Mixe
maize.
Plants grown in Sierra Mixe during 2010 (light gray bars), 2011 (dark grey
bars), and 2012 (black bars) were evaluated for %Ndfa; values were
calculated using δ15N values in Table 1
<http://journals.plos.org/plosbiology/article?id=10.1371/journal.pbio.2006352#pbio-2006352-t001>.
Bar = standard error of the mean. %Ndfa, percent of nitrogen derived from
the atmosphere.
https://doi.org/10.1371/journal.pbio.2006352.s007
(EPS)
S1 Table.
<http://journals.plos.org/plosbiology/article/file?type=supplementary&id=info:doi/10.1371/journal.pbio.2006352.s008>
δ15N (‰) was determined in Sierra Mixe maize, and reference plants sampled
from three 10 × 10 m locations were randomly selected from farmers’ fields
in Sierra Mixe.
From each location, 6 leaf samples were randomly sampled from Sierra Mixe
maize plants and 6 leaf samples from each of 2 reference plants. The third
emergent leaf of each maize plant was sampled. Reference plants were
selected from the most abundant weed species within each sample location,
and from a plant family (Asteraceae and Ranunculaceae) that is neither
actinorhizal nor leguminous nor has members known to associate with
diazotrophic bacteria. δ15N was determined for each plant sampled, and
%Ndfa was calculated for Sierra Mixe maize according to the equation 2 in [
19
<http://journals.plos.org/plosbiology/article?id=10.1371/journal.pbio.2006352#pbio.2006352.ref019>].
Values are given as mean and s.e. Different letters indicate statistically
supported groups (one-way ANOVA, *P* < 0.05). %Ndfa, percent of nitrogen
derived from the atmosphere.
https://doi.org/10.1371/journal.pbio.2006352.s008
(DOCX)
S2 Table.
<http://journals.plos.org/plosbiology/article/file?type=supplementary&id=info:doi/10.1371/journal.pbio.2006352.s009>
δN15 (‰) distribution in root and shoot samples.
Data are from a single sampling date (May 2012) in Sierra Mixe maize, with
30 replicates analyzed for each sample reported.
https://doi.org/10.1371/journal.pbio.2006352.s009
(DOCX)
S3 Table.
<http://journals.plos.org/plosbiology/article/file?type=supplementary&id=info:doi/10.1371/journal.pbio.2006352.s010>Reference
plants sampled in the Fields 3 and 4 in Sierra Mixe in 2011 and 2012 and
summarized in Table 2B
<http://journals.plos.org/plosbiology/article?id=10.1371/journal.pbio.2006352#pbio-2006352-t002>
.
https://doi.org/10.1371/journal.pbio.2006352.s010
(DOCX)
S4 Table.
<http://journals.plos.org/plosbiology/article/file?type=supplementary&id=info:doi/10.1371/journal.pbio.2006352.s011>Shoot
and root height and diameter measurements for field trials in Sierra Mixe
in 2016 and 2017.
Numbers followed by different letters are significantly different based on
Least Significant difference at *p* = 0.05.
https://doi.org/10.1371/journal.pbio.2006352.s011
(DOCX)
S5 Table.
<http://journals.plos.org/plosbiology/article/file?type=supplementary&id=info:doi/10.1371/journal.pbio.2006352.s012>Soil
analyses for samples taken at 0–60 cm before planting for fields in Sierra
Mixe, Mexico.
(A) Macroelements and soil characteristics. (B) Microelements for fields in
2017.
https://doi.org/10.1371/journal.pbio.2006352.s012
(DOCX)
Acknowledgments
This paper is dedicated to the life and memory of Cristobal Heitmann.
Cristobal’s energy and enthusiasm was a major catalyst in completing this
research. He died tragically while the manuscript was under review. We
thank Vicente Vasquez and Maria del Refugio Vasquez for assistance in
developing the program in Mexico; Carmen Ortega and Saulon Zamora for
sample collection and field trial assistance; Shawn Kaeppler, Natalia de
Leon, and Jillian Foerster for field assistance; Nguyet Dao for
microbial 15N-fixation
assays; Harry Read for processing 15N2-enrichment samples; John Zhang for
assistance with library construction; and Armando Garcia-Llanos for
assistance in sample processing. We thank the Comisiriado of the Sierra
Mixe, Mexico, for their support and access to community genetic resources.
References
1. 1. Bulgarelli D, Rott M, Schlaeppi K, van Themaat EVL, Ahmadinejad N,
Assenza F, et al. Revealing structure and assembly cues for Arabidopsis
root-inhabiting bacterial microbiota. Nature. 2012;488(7409):91–5.
pmid:22859207
- View Article <https://doi.org/10.1038/nature11336>
- PubMed/NCBI <http://www.ncbi.nlm.nih.gov/pubmed/22859207>
- Google Scholar
<http://scholar.google.com/scholar?q=Revealing+structure+and+assembly+cues+for+Arabidopsis+root-inhabiting+bacterial+microbiota+Bulgarelli+2012>
2. 2. Lundberg DS, Lebeis SL, Paredes SH, Yourstone S, Gehring J,
Malfatti S, et al. Defining the core Arabidopsis thaliana root microbiome.
Nature. 2012;488(7409):86–+. pmid:22859206
- View Article <https://doi.org/10.1038/nature11237>
- PubMed/NCBI <http://www.ncbi.nlm.nih.gov/pubmed/22859206>
- Google Scholar
<http://scholar.google.com/scholar?q=Defining+the+core+Arabidopsis+thaliana+root+microbiome+Lundberg+2012>
3. 3. Peiffer JA, Spor A, Koren O, Jin Z, Tringe SG, Dangl JL, et al.
Diversity and heritability of the maize rhizosphere microbiome under field
conditions. Proceedings of the National Academy of Sciences of the United
States of America. 2013;110(16):6548–53. pmid:23576752
- View Article <https://doi.org/10.1073/pnas.1302837110>
- PubMed/NCBI <http://www.ncbi.nlm.nih.gov/pubmed/23576752>
- Google Scholar
<http://scholar.google.com/scholar?q=Diversity+and+heritability+of+the+maize+rhizosphere+microbiome+under+field+conditions+Peiffer+2013>
4. 4. Roesch LFW, Camargo FAO, Bento FM, Triplett EW. Biodiversity of
diazotrophic bacteria within the soil, root and stem of field-grown maize.
Plant and Soil. 2008;302(1–2):91–104.
- View Article <https://doi.org/10.1007/s11104-007-9458-3>
- Google Scholar
<http://scholar.google.com/scholar?q=Biodiversity+of+diazotrophic+bacteria+within+the+soil%2C+root+and+stem+of+field-grown+maize+Roesch+2008>
5. 5. Triplett EW. Diazotrophic endophytes: Progress and prospects for
nitrogen fixation in monocots. Plant and Soil. 1996;186(1):29–38.
- View Article <https://doi.org/10.1007/bf00035052>
- Google Scholar
<http://scholar.google.com/scholar?q=Diazotrophic+endophytes%3A+Progress+and+prospects+for+nitrogen+fixation+in+monocots+Triplett+1996>
6. 6. Mus F, Crook M, Garcia K, Costas A, Geddes B, Kouri E, et al.
Symbiotic Nitrogen Fixation and the Challenges to Its Extension to
Nonlegumes. Applied and Environmental Microbiology. 2016;82(13):3698–710.
pmid:27084023
- View Article <https://doi.org/10.1128/AEM.01055-16>
- PubMed/NCBI <http://www.ncbi.nlm.nih.gov/pubmed/27084023>
- Google Scholar
<http://scholar.google.com/scholar?q=Symbiotic+Nitrogen+Fixation+and+the+Challenges+to+Its+Extension+to+Nonlegumes+Mus+2016>
7. 7. Beatty P, Good A. Future Prospects for Cereals That Fix Nitrogen.
Science. 2011;333(6041):416–7. pmid:21778391
- View Article <https://doi.org/10.1126/science.1209467>
- PubMed/NCBI <http://www.ncbi.nlm.nih.gov/pubmed/21778391>
- Google Scholar
<http://scholar.google.com/scholar?q=Future+Prospects+for+Cereals+That+Fix+Nitrogen+Beatty+2011>
8. 8. Urquiaga S, Xavier RP, de Morais RF, Batista RB, Schultz N, Leite
JM, et al. Evidence from field nitrogen balance and N-15 natural abundance
data for the contribution of biological N-2 fixation to Brazilian sugarcane
varieties. Plant and Soil. 2012;356(1–2):5–21.
- View Article <https://doi.org/10.1007/s11104-011-1016-3>
- Google Scholar
<http://scholar.google.com/scholar?q=Evidence+from+field+nitrogen+balance+and+N-15+natural+abundance+data+for+the+contribution+of+biological+N-2+fixation+to+Brazilian+sugarcane+varieties+Urquiaga+2012>
9. 9. Luo T, Ou-Yang XQ, Yang LT, Li YR, Song XP, Zhang GM, et al.
Raoultella sp strain L03 fixes N-2 in association with micropropagated
sugarcane plants. Journal of Basic Microbiology. 2016;56(8):934–40.
pmid:27059698
- View Article <https://doi.org/10.1002/jobm.201500738>
- PubMed/NCBI <http://www.ncbi.nlm.nih.gov/pubmed/27059698>
- Google Scholar
<http://scholar.google.com/scholar?q=Raoultella+sp+strain+L03+fixes+N-2+in+association+with+micropropagated+sugarcane+plants+Luo+2016>
10. 10. Sevilla M, Burris R, Gunapala N, Kennedy C. Comparison of
benefit to sugarcane plant growth and N-15(2) incorporation following
inoculation of sterile plants with Acetobacter diazotrophicus wild-type and
Nif(-) mutant strains. Molecular Plant-Microbe Interactions.
2001;14(3):358–66. pmid:11277433
- View Article <https://doi.org/10.1094/MPMI.2001.14.3.358>
- PubMed/NCBI <http://www.ncbi.nlm.nih.gov/pubmed/11277433>
- Google Scholar
<http://scholar.google.com/scholar?q=Comparison+of+benefit+to+sugarcane+plant+growth+and+N-15%282%29+incorporation+following+inoculation+of+sterile+plants+with+Acetobacter+diazotrophicus+wild-type+and+Nif%28-%29+mutant+strains+Sevilla+2001>
11. 11. Keymer D, Kent A. Contribution of nitrogen fixation to first
year Miscanthus x giganteus. Global Change Biology Bioenergy.
2014;6(5):577–86.
- View Article <https://doi.org/10.1111/gcbb.12095>
- Google Scholar
<http://scholar.google.com/scholar?q=Contribution+of+nitrogen+fixation+to+first+year+Miscanthus+x+giganteus+Keymer+2014>
12. 12. Pankievicz V, do Amaral F, Santos K, Agtuca B, Xu Y, Schueller
M, et al. Robust biological nitrogen fixation in a model grass-bacterial
association. Plant Journal. 2015;81(6):907–19. pmid:25645593
- View Article <https://doi.org/10.1111/tpj.12777>
- PubMed/NCBI <http://www.ncbi.nlm.nih.gov/pubmed/25645593>
- Google Scholar
<http://scholar.google.com/scholar?q=Robust+biological+nitrogen+fixation+in+a+model+grass-bacterial+association+Pankievicz+2015>
13. 13. Okon Y, Heytler P, Hardy R. N2-fixation by
Azospirillum-brasilense and its incorporation into host Setaria-italica.
Applied and Environmental Microbiology. 1983;46(3):694–7. pmid:16346386
- View Article
<http://journals.plos.org/plosbiology/article?id=10.1371/journal.pbio.2006352#>
- PubMed/NCBI <http://www.ncbi.nlm.nih.gov/pubmed/16346386>
- Google Scholar
<http://scholar.google.com/scholar?q=N2-fixation+by+Azospirillum-brasilense+and+its+incorporation+into+host+Setaria-italica+Okon+1983>
14. 14. Hurek T, Handley L, Reinhold-Hurek B, Piche Y. Azoarcus grass
endophytes contribute fixed nitrogen to the plant in an unculturable state.
Molecular Plant-Microbe Interactions. 2002;15(3):233–42. pmid:11952126
- View Article <https://doi.org/10.1094/MPMI.2002.15.3.233>
- PubMed/NCBI <http://www.ncbi.nlm.nih.gov/pubmed/11952126>
- Google Scholar
<http://scholar.google.com/scholar?q=Azoarcus+grass+endophytes+contribute+fixed+nitrogen+to+the+plant+in+an+unculturable+state+Hurek+2002>
15. 15. Boddey R, DeOliviera O, Urquiaga S, Reis V, DeOliveres F,
Baldini V, et al. Biological nitrogen-fixation associated with sugar-cane
and rice—contributions and prospects for improvement. Plant and Soil.
1995;174(1–2):195–209.
- View Article <https://doi.org/10.1007/BF00032247>
- Google Scholar
<http://scholar.google.com/scholar?q=Biological+nitrogen-fixation+associated+with+sugar-cane+and+rice%E2%80%94contributions+and+prospects+for+improvement+Boddey+1995>
16. 16. Gyaneshwar P, James E, Reddy P, Ladha J. Herbaspirillum
colonization increases growth and nitrogen accumulation in
aluminium-tolerant rice varieties. New Phytologist. 2002;154(1):131–45.
- View Article <https://doi.org/10.1046/j.1469-8137.2002.00371.x>
- Google Scholar
<http://scholar.google.com/scholar?q=Herbaspirillum+colonization+increases+growth+and+nitrogen+accumulation+in+aluminium-tolerant+rice+varieties+Gyaneshwar+2002>
17. 17. Iniguez A, Dong Y, Triplett E. Nitrogen fixation in wheat
provided by Klebsiella pneumoniae 342. Molecular Plant-Microbe
Interactions. 2004;17(10):1078–85. pmid:15497400
- View Article <https://doi.org/10.1094/MPMI.2004.17.10.1078>
- PubMed/NCBI <http://www.ncbi.nlm.nih.gov/pubmed/15497400>
- Google Scholar
<http://scholar.google.com/scholar?q=Nitrogen+fixation+in+wheat+provided+by+Klebsiella+pneumoniae+342+Iniguez+2004>
18. 18. Montanez A, Abreu C, Gill P, Hardarson G, Sicardi M. Biological
nitrogen fixation in maize (Zea mays L.) by N-15 isotope-dilution and
identification of associated culturable diazotrophs. Biology and Fertility
of Soils. 2009;45(3):253–63.
- View Article <https://doi.org/10.1007/s00374-008-0322-2>
- Google Scholar
<http://scholar.google.com/scholar?q=Biological+nitrogen+fixation+in+maize+%28Zea+mays+L.%29+by+N-15+isotope-dilution+and+identification+of+associated+culturable+diazotrophs+Montanez+2009>
19. 19. Santos C, Vieira J, Sellstedt A, Normand P, Moradas-Ferreira P,
Tavares F. Modulation of Frankia alni ACN14a oxidative stress response:
activity, expression and phylogeny of catalases. Physiologia Plantarum.
2007;130(3):454–63.
- View Article <https://doi.org/10.1111/j.1399-3054.2007.00868.x>
- Google Scholar
<http://scholar.google.com/scholar?q=Modulation+of+Frankia+alni+ACN14a+oxidative+stress+response%3A+activity%2C+expression+and+phylogeny+of+catalases+Santos+2007>
20. 20. deSalamone I, Dobereiner J, Urquiaga S, Boddey R. Biological
nitrogen fixation in Azospirillum strain-maize genotype associations as
evaluated by the N-15 isotope dilution technique. Biology and Fertility of
Soils. 1996;23(3):249–56.
- View Article <https://doi.org/10.1007/s003740050168>
- Google Scholar
<http://scholar.google.com/scholar?q=Biological+nitrogen+fixation+in+Azospirillum+strain-maize+genotype+associations+as+evaluated+by+the+N-15+isotope+dilution+technique+deSalamone+1996>
21. 21. Boddey R, Alves B, Urquiaga S, Malik K, Mirza M, Ladha J.
Evaluation of biological nitrogen fixation associated with non-legumes.
Nitrogen Fixation With Non-Legumes. 1998;79:287–305.
- View Article
<http://journals.plos.org/plosbiology/article?id=10.1371/journal.pbio.2006352#>
- Google Scholar
<http://scholar.google.com/scholar?q=Evaluation+of+biological+nitrogen+fixation+associated+with+non-legumes+Boddey+1998>
22. 22. Hardarson G. Methods for enhancing symbiotic nitrogen-fixation.
Plant and Soil. 1993;152(1):1–17.
- View Article <https://doi.org/10.1007/BF00016329>
- Google Scholar
<http://scholar.google.com/scholar?q=Methods+for+enhancing+symbiotic+nitrogen-fixation+Hardarson+1993>
23. 23. Estrada P, Mavingui P, Cournoyer B, Fontaine F, Balandreau J,
Caballero-Mellado J. A N-2-fixing endophytic Burkholderia sp associated
with maize plants cultivated in Mexico. Canadian Journal of Microbiology.
2002;48(4):285–94. pmid:12030700
- View Article <https://doi.org/10.1139/w02-023>
- PubMed/NCBI <http://www.ncbi.nlm.nih.gov/pubmed/12030700>
- Google Scholar
<http://scholar.google.com/scholar?q=A+N-2-fixing+endophytic+Burkholderia+sp+associated+with+maize+plants+cultivated+in+Mexico+Estrada+2002>
24. 24. McCully ME, Boyer JS. The expansion of maize root-cap mucilage
during hydration .3. Changes in water potential and water content.
Physiologia Plantarum. 1997;99(1):169–77.
- View Article <https://doi.org/10.1111/j.1399-3054.1997.tb03445.x>
- Google Scholar
<http://scholar.google.com/scholar?q=The+expansion+of+maize+root-cap+mucilage+during+hydration+.3.+Changes+in+water+potential+and+water+content+McCully+1997>
25. 25. Sealey LJ, McCully ME, Canny MJ. The expansion of maize root-cap
mucilage during hydration. 1. Kinetics. Physiologia Plantarum.
1995;93(1):38–46.
- View Article <https://doi.org/10.1034/j.1399-3054.1995.930107.x>
- Google Scholar
<http://scholar.google.com/scholar?q=The+expansion+of+maize+root-cap+mucilage+during+hydration.+1.+Kinetics+Sealey+1995>
26. 26. Delaux PM, Radhakrishnan GV, Jayaraman D, Cheem J, Malbreil M,
Volkening JD, et al. Algal ancestor of land plants was preadapted for
symbiosis. Proceedings of the National Academy of Sciences of the United
States of America. 2015;112(43):13390–5. pmid:26438870
- View Article <https://doi.org/10.1073/pnas.1515426112>
- PubMed/NCBI <http://www.ncbi.nlm.nih.gov/pubmed/26438870>
- Google Scholar
<http://scholar.google.com/scholar?q=Algal+ancestor+of+land+plants+was+preadapted+for+symbiosis+Delaux+2015>
27. 27. Dennis PG, Miller AJ, Hirsch PR. Are root exudates more
important than other sources of rhizodeposits in structuring rhizosphere
bacterial communities? Fems Microbiology Ecology. 2010;72(3):313–27.
pmid:20370828
- View Article <https://doi.org/10.1111/j.1574-6941.2010.00860.x>
- PubMed/NCBI <http://www.ncbi.nlm.nih.gov/pubmed/20370828>
- Google Scholar
<http://scholar.google.com/scholar?q=Are+root+exudates+more+important+than+other+sources+of+rhizodeposits+in+structuring+rhizosphere+bacterial+communities%3F+Dennis+2010>
28. 28. Knee EM, Gong FC, Gao MS, Teplitski M, Jones AR, Foxworthy A, et
al. Root mucilage from pea and its utilization by rhizosphere bacteria as a
sole carbon source. Molecular Plant-Microbe Interactions.
2001;14(6):775–84. pmid:11386373
- View Article <https://doi.org/10.1094/MPMI.2001.14.6.775>
- PubMed/NCBI <http://www.ncbi.nlm.nih.gov/pubmed/11386373>
- Google Scholar
<http://scholar.google.com/scholar?q=Root+mucilage+from+pea+and+its+utilization+by+rhizosphere+bacteria+as+a+sole+carbon+source+Knee+2001>
29. 29. Li Y, Fu Y, Huang J, Wu C, Zheng C. Transcript profiling during
the early development of the maize brace root via Solexa sequencing. Febs
Journal. 2011;278(1):156–66. pmid:21122072
- View Article <https://doi.org/10.1111/j.1742-4658.2010.07941.x>
- PubMed/NCBI <http://www.ncbi.nlm.nih.gov/pubmed/21122072>
- Google Scholar
<http://scholar.google.com/scholar?q=Transcript+profiling+during+the+early+development+of+the+maize+brace+root+via+Solexa+sequencing+Li+2011>
30. 30. Hoppe D, McCully M, Wenzel C. The nodal roots of Zea—Their
development in relation to structural features of the stem. Canadian
Journal of Botany-Revue Canadienne De Botanique. 1986;64(11):2524–37.
- View Article <https://doi.org/10.1139/b86-335>
- Google Scholar
<http://scholar.google.com/scholar?q=The+nodal+roots+of+Zea%E2%80%94Their+development+in+relation+to+structural+features+of+the+stem+Hoppe+1986>
31. 31. Hochholdinger F, Woll K, Sauer M, Dembinsky D. Genetic
dissection of root formation in maize (Zea mays) reveals root-type specific
developmental programmes. Annals of Botany. 2004;93(4):359–68.
pmid:14980975
- View Article <https://doi.org/10.1093/aob/mch056>
- PubMed/NCBI <http://www.ncbi.nlm.nih.gov/pubmed/14980975>
- Google Scholar
<http://scholar.google.com/scholar?q=Genetic+dissection+of+root+formation+in+maize+%28Zea+mays%29+reveals+root-type+specific+developmental+programmes+Hochholdinger+2004>
32. 32. Bacic A, Moody SF, Clarke AE. Structural-analysis of secreted
root slime from maize (Zea-mays-L). Plant Physiology. 1986;80(3):771–7.
pmid:16664700
- View Article <https://doi.org/10.1104/pp.80.3.771>
- PubMed/NCBI <http://www.ncbi.nlm.nih.gov/pubmed/16664700>
- Google Scholar
<http://scholar.google.com/scholar?q=Structural-analysis+of+secreted+root+slime+from+maize+%28Zea-mays-L%29+Bacic+1986>
33. 33. Dos Santos PC, Fang Z, Mason SW, Setubal JC, Dixon R.
Distribution of nitrogen fixation and nitrogenase-like sequences amongst
microbial genomes. Bmc Genomics. 2012;13. pmid:22554235
- View Article <https://doi.org/10.1186/1471-2164-13-162>
- PubMed/NCBI <http://www.ncbi.nlm.nih.gov/pubmed/22554235>
- Google Scholar
<http://scholar.google.com/scholar?q=Distribution+of+nitrogen+fixation+and+nitrogenase-like+sequences+amongst+microbial+genomes+Dos+Santos+2012>
34. 34. Vessey JK. Measurement of nitrogenase activity in legume
root-nodules—In defense of the acetylene-reduction assay. Plant and Soil.
1994;158(2):151–62.
- View Article <https://doi.org/10.1007/bf00009490>
- Google Scholar
<http://scholar.google.com/scholar?q=Measurement+of+nitrogenase+activity+in+legume+root-nodules%E2%80%94In+defense+of+the+acetylene-reduction+assay+Vessey+1994>
35. 35. Hunt S, Layzell DB. Gas-exchange of legume nodules and the
regulation of nitrogenase activity. Annual Review of Plant Physiology and
Plant Molecular Biology. 1993;44:483–511.
- View Article <https://doi.org/10.1146/annurev.pp.44.060193.002411>
- Google Scholar
<http://scholar.google.com/scholar?q=Gas-exchange+of+legume+nodules+and+the+regulation+of+nitrogenase+activity+Hunt+1993>
36. 36. Marchal K, Vanderleyden J. The "oxygen paradox" of
dinitrogen-fixing bacteria. Biology and Fertility of Soils.
2000;30(5–6):363–73.
- View Article <https://doi.org/10.1007/s003740050017>
- Google Scholar
<http://scholar.google.com/scholar?q=The+%26quot%3Boxygen+paradox%26quot%3B+of+dinitrogen-fixing+bacteria+Marchal+2000>
37. 37. Boddey RM, Polidoro JC, Resende AS, Alves BJR, Urquiaga S. Use
of the N-15 natural abundance technique for the quantification of the
contribution of N-2 fixation to sugar cane and other grasses. Australian
Journal of Plant Physiology. 2001;28(9):889–95.
- View Article <https://doi.org/10.1071/pp01058>
- Google Scholar
<http://scholar.google.com/scholar?q=Use+of+the+N-15+natural+abundance+technique+for+the+quantification+of+the+contribution+of+N-2+fixation+to+sugar+cane+and+other+grasses+Boddey+2001>
38. 38. Bremer E, Vankessel C. Appraisal of the N-15 natural-abundance
method for quantifying dinitrogen fixation. Soil Science Society of America
Journal. 1990;54(2):404–11.
- View Article
<https://doi.org/10.2136/sssaj1990.03615995005400020018x>
- Google Scholar
<http://scholar.google.com/scholar?q=Appraisal+of+the+N-15+natural-abundance+method+for+quantifying+dinitrogen+fixation+Bremer+1990>
39. 39. Teixeira FCP, Reinert F, Rumjanek NG, Boddey RM. Quantification
of the contribution biological nitrogen fixation to Cratylia mollis using
the N-15 natural abundance technique in the semi-arid Caatinga region of
Brazil. Soil Biology & Biochemistry. 2006;38(7):1989–93.
- View Article <https://doi.org/10.1016/j.soilbio.2005.11.013>
- Google Scholar
<http://scholar.google.com/scholar?q=Quantification+of+the+contribution+biological+nitrogen+fixation+to+Cratylia+mollis+using+the+N-15+natural+abundance+technique+in+the+semi-arid+Caatinga+region+of+Brazil+Teixeira+2006>
40. 40. Doughton JA, Saffigna PG, Vallis I, Mayer RJ. Nitrogen-fixation
in chickpea. 2. Comparison of N-15 enrichment and N-15 natural-abundance
methods for estimating nitrogen-fixation. Australian Journal of
Agricultural Research. 1995;46(1):225–36.
- View Article <https://doi.org/10.1071/ar9950225>
- Google Scholar
<http://scholar.google.com/scholar?q=Nitrogen-fixation+in+chickpea.+2.+Comparison+of+N-15+enrichment+and+N-15+natural-abundance+methods+for+estimating+nitrogen-fixation+Doughton+1995>
41. 41. S.W. R, J.J. H, G.O. B. How a corn plant develops. Iowa State
Univ. Coop Ext. Serv. Spec. Rep. 48: Iowa State Univ., Ames.; 1986.
42. 42. Wilson S, Bottjer D, Church M, Karl D. Comparative Assessment of
Nitrogen Fixation Methodologies, Conducted in the Oligotrophic North
Pacific Ocean. Applied and Environmental Microbiology. 2012;78(18):6516–23.
pmid:22773638
- View Article <https://doi.org/10.1128/AEM.01146-12>
- PubMed/NCBI <http://www.ncbi.nlm.nih.gov/pubmed/22773638>
- Google Scholar
<http://scholar.google.com/scholar?q=Comparative+Assessment+of+Nitrogen+Fixation+Methodologies%2C+Conducted+in+the+Oligotrophic+North+Pacific+Ocean+Wilson+2012>
43. 43. Hudd G, Lloydjones C, Hillcottingham D. Comparison of
acetylene-reduction and N-15 techniques for the determination of
nitrogen-fixation by field bean (Vicia-faba) nodules. Physiologia
Plantarum. 1980;48(1):111–5.
- View Article <https://doi.org/10.1111/j.1399-3054.1980.tb03227.x>
- Google Scholar
<http://scholar.google.com/scholar?q=Comparison+of+acetylene-reduction+and+N-15+techniques+for+the+determination+of+nitrogen-fixation+by+field+bean+%28Vicia-faba%29+nodules+Hudd+1980>
44. 44. Li R, Han Y, Lv P, Du R, Liu G. Molecular mapping of the brace
root traits in sorghum (Sorghum bicolor L. Moench). Breeding Science.
2014;64(2):193–8. pmid:24987306
- View Article <https://doi.org/10.1270/jsbbs.64.193>
- PubMed/NCBI <http://www.ncbi.nlm.nih.gov/pubmed/24987306>
- Google Scholar
<http://scholar.google.com/scholar?q=Molecular+mapping+of+the+brace+root+traits+in+sorghum+%28Sorghum+bicolor+L.+Moench%29+Li+2014>
45. 45. Caporaso J, Lauber C, Walters W, Berg-Lyons D, Lozupone C,
Turnbaugh P, et al. Global patterns of 16S rRNA diversity at a depth of
millions of sequences per sample. Proceedings of the National Academy of
Sciences of the United States of America. 2011;108:4516–22. pmid:20534432
- View Article <https://doi.org/10.1073/pnas.1000080107>
- PubMed/NCBI <http://www.ncbi.nlm.nih.gov/pubmed/20534432>
- Google Scholar
<http://scholar.google.com/scholar?q=Global+patterns+of+16S+rRNA+diversity+at+a+depth+of+millions+of+sequences+per+sample+Caporaso+2011>
46. 46. Caporaso J, Lauber C, Walters W, Berg-Lyons D, Huntley J, Fierer
N, et al. Ultra-high-throughput microbial community analysis on the
Illumina HiSeq and MiSeq platforms. Isme Journal. 2012;6(8):1621–4.
pmid:22402401
- View Article <https://doi.org/10.1038/ismej.2012.8>
- PubMed/NCBI <http://www.ncbi.nlm.nih.gov/pubmed/22402401>
- Google Scholar
<http://scholar.google.com/scholar?q=Ultra-high-throughput+microbial+community+analysis+on+the+Illumina+HiSeq+and+MiSeq+platforms+Caporaso+2012>
47. 47. Callahan BJ, McMurdie PJ, Rosen MJ, Han AW, Johnson AJA, Holmes
SP. DADA2: High-resolution sample inference from Illumina amplicon data.
Nature Methods. 2016;13(7):581–+. pmid:27214047
- View Article <https://doi.org/10.1038/nmeth.3869>
- PubMed/NCBI <http://www.ncbi.nlm.nih.gov/pubmed/27214047>
- Google Scholar
<http://scholar.google.com/scholar?q=DADA2%3A+High-resolution+sample+inference+from+Illumina+amplicon+data+Callahan+2016>
48. 48. McMurdie P, Holmes S. phyloseq: An R Package for Reproducible
Interactive Analysis and Graphics of Microbiome Census Data. PLoS ONE.
2013;8(4). pmid:23630581
- View Article <https://doi.org/10.1371/journal.pone.0061217>
- PubMed/NCBI <http://www.ncbi.nlm.nih.gov/pubmed/23630581>
- Google Scholar
<http://scholar.google.com/scholar?q=phyloseq%3A+An+R+Package+for+Reproducible+Interactive+Analysis+and+Graphics+of+Microbiome+Census+Data+McMurdie+2013>
49. 49. Love M, Huber W, Anders S. Moderated estimation of fold change
and dispersion for RNA-seq data with DESeq2. Genome Biology. 2014;15(12).
pmid:25516281
- View Article <https://doi.org/10.1186/s13059-014-0550-8>
- PubMed/NCBI <http://www.ncbi.nlm.nih.gov/pubmed/25516281>
- Google Scholar
<http://scholar.google.com/scholar?q=Moderated+estimation+of+fold+change+and+dispersion+for+RNA-seq+data+with+DESeq2+Love+2014>
50. 50. Bolger A, Lohse M, Usadel B. Trimmomatic: a flexible trimmer for
Illumina sequence data. Bioinformatics. 2014;30(15):2114–20. pmid:24695404
- View Article <https://doi.org/10.1093/bioinformatics/btu170>
- PubMed/NCBI <http://www.ncbi.nlm.nih.gov/pubmed/24695404>
- Google Scholar
<http://scholar.google.com/scholar?q=Trimmomatic%3A+a+flexible+trimmer+for+Illumina+sequence+data+Bolger+2014>
51. 51. Langmead B, Salzberg S. Fast gapped-read alignment with Bowtie
2. Nature Methods. 2012;9(4):357–U54. pmid:22388286
- View Article <https://doi.org/10.1038/nmeth.1923>
- PubMed/NCBI <http://www.ncbi.nlm.nih.gov/pubmed/22388286>
- Google Scholar
<http://scholar.google.com/scholar?q=Fast+gapped-read+alignment+with+Bowtie+2+Langmead+2012>
52. 52. Menzel P, Ng K, Krogh A. Fast and sensitive taxonomic
classification for metagenomics with Kaiju. Nature Communications. 2016;7.
pmid:27071849
- View Article <https://doi.org/10.1038/ncomms11257>
- PubMed/NCBI <http://www.ncbi.nlm.nih.gov/pubmed/27071849>
- Google Scholar
<http://scholar.google.com/scholar?q=Fast+and+sensitive+taxonomic+classification+for+metagenomics+with+Kaiju+Menzel+2016>
53. 53. Darling A, Jospin G, Lowe E, Matsen FI, Bik H, Eisen J.
PhyloSift: phylogenetic analysis of genomes and metagenomes. Peerj. 2014;2.
pmid:24482762
- View Article <https://doi.org/10.7717/peerj.243>
- PubMed/NCBI <http://www.ncbi.nlm.nih.gov/pubmed/24482762>
- Google Scholar
<http://scholar.google.com/scholar?q=PhyloSift%3A+phylogenetic+analysis+of+genomes+and+metagenomes+Darling+2014>
54. 54. Matsen F, Evans S. Edge Principal Components and Squash
Clustering: Using the Special Structure of Phylogenetic Placement Data for
Sample Comparison. PLoS ONE. 2013;8(3). pmid:23505415
- View Article <https://doi.org/10.1371/journal.pone.0056859>
- PubMed/NCBI <http://www.ncbi.nlm.nih.gov/pubmed/23505415>
- Google Scholar
<http://scholar.google.com/scholar?q=Edge+Principal+Components+and+Squash+Clustering%3A+Using+the+Special+Structure+of+Phylogenetic+Placement+Data+for+Sample+Comparison+Matsen+2013>
55. 55. Larkin M, Blackshields G, Brown N, Chenna R, McGettigan P,
McWilliam H, et al. Clustal W and clustal X version 2.0. Bioinformatics.
2007;23(21):2947–8. pmid:17846036
- View Article <https://doi.org/10.1093/bioinformatics/btm404>
- PubMed/NCBI <http://www.ncbi.nlm.nih.gov/pubmed/17846036>
- Google Scholar
<http://scholar.google.com/scholar?q=Clustal+W+and+clustal+X+version+2.0+Larkin+2007>
56. 56. Sievers F, Wilm A, Dineen D, Gibson T, Karplus K, Li W, et al.
Fast, scalable generation of high-quality protein multiple sequence
alignments using Clustal Omega. Molecular Systems Biology. 2011;7.
pmid:21988835
- View Article <https://doi.org/10.1038/msb.2011.75>
- PubMed/NCBI <http://www.ncbi.nlm.nih.gov/pubmed/21988835>
- Google Scholar
<http://scholar.google.com/scholar?q=Fast%2C+scalable+generation+of+high-quality+protein+multiple+sequence+alignments+using+Clustal+Omega+Sievers+2011>
57. 57. Price M, Dehal P, Arkin A. FastTree 2-Approximately
Maximum-Likelihood Trees for Large Alignments. PLoS ONE. 2010;5(3).
pmid:20224823
- View Article <https://doi.org/10.1371/journal.pone.0009490>
- PubMed/NCBI <http://www.ncbi.nlm.nih.gov/pubmed/20224823>
- Google Scholar
<http://scholar.google.com/scholar?q=FastTree+2-Approximately+Maximum-Likelihood+Trees+for+Large+Alignments+Price+2010>
58. 58. Haft D, Selengut J, White O. The TIGRFAMs database of protein
families. Nucleic Acids Research. 2003;31(1):371–3. pmid:12520025
- View Article <https://doi.org/10.1093/nar/gkg128>
- PubMed/NCBI <http://www.ncbi.nlm.nih.gov/pubmed/12520025>
- Google Scholar
<http://scholar.google.com/scholar?q=The+TIGRFAMs+database+of+protein+families+Haft+2003>
59. 59. Kahn ML, Parra-Colmenares A, Ford CL, Kaser F, McCaskill D,
Ketchum RE. A mass spectrometry method for measuring N-15 incorporation
into pheophytin. Analytical Biochemistry. 2002;307(2):219–25. pmid:12202237
- View Article <https://doi.org/10.1016/s0003-2697%2802%2900046-5>
- PubMed/NCBI <http://www.ncbi.nlm.nih.gov/pubmed/12202237>
- Google Scholar
<http://scholar.google.com/scholar?q=A+mass+spectrometry+method+for+measuring+N-15+incorporation+into+pheophytin+Kahn+2002>
permaculture mailing list
[email protected]
subscribe/unsubscribe|user config|list info:
https://lists.ibiblio.org/mailman/listinfo/permaculture