WormBase release WS177 now online

"Todd Harris" <[email protected]> Wed, 11 Jul 2007 18:01:31 -0400
Newsgroups gmane.science.biology.wormbase.general
Message-ID <[email protected]>
This is an automatic announcement that WormBase
(http://www.wormbase.org) has just been updated.  New releases occur
roughly every three weeks.

The text of the AceDB release notes, which contains highlights of the
new data is attached.  You can download the full AceDB files from:

   ftp://ftp.sanger.ac.uk/pub/wormbase/current_release/
   or
   ftp://ftp.wormbase.org/pub/wormbase/acedb/current_release

Additional information on the release, including any necessary patches or bug
fixes can be found on the WormBaseWiki:

   http://www.wormbase.org/wiki/index.php/WSWS177

New release of WormBase WS177, Wormpep177 and Wormrna177 Fri Jun 15 15:39:40 BST 2007


WS177 was built by Michael Han
======================================================================

This directory includes:
i)   database.WS177.*.tar.gz     -   compressed data for new release
ii)  models.wrm.WS177            -   the latest database schema (also in above database files)
iii) CHROMOSOMES/subdir          -   contains 3 files (DNA, GFF & AGP per chromosome)
iv)  WS177-WS176.dbcomp          -   log file reporting difference from last release
v)   wormpep177.tar.gz           -   full Wormpep distribution corresponding to WS177
vi)   wormrna177.tar.gz          -   latest WormRNA release containing non-coding RNA's in the genome
vii)  confirmed_genes.WS177.gz   -   DNA sequences of all genes confirmed by EST &/or cDNA
viii) cDNA2orf.WS177.gz          -   Latest set of ORF connections to each cDNA (EST, OST, mRNA)
ix)   gene_interpolated_map_positions.WS177.gz    - Interpolated map positions for each coding/RNA gene
x)    clone_interpolated_map_positions.WS177.gz   - Interpolated map positions for each clone
xi)   best_blastp_hits.WS177.gz  - for each C. elegans WormPep protein, lists Best blastp match to
                            human, fly, yeast, C. briggsae, and SwissProt & TrEMBL proteins.
xii)  best_blastp_hits_brigprot.WS177.gz   - for each C. briggsae protein, lists Best blastp match to
                                     human, fly, yeast, C. elegans, and SwissProt & TrEMBL proteins.
xiii) geneIDs.WS177.gz   - list of all current gene identifiers with CGC & molecular names (when known)
xiv)  PCR_product2gene.WS177.gz   - Mappings between PCR products and overlapping Genes


Release notes on the web:
-------------------------
http://www.wormbase.org/wiki/index.php/Release_notes



Genome sequence composition:
----------------------------

       	WS177       	WS176      	change
----------------------------------------------
a    	32365888	32365889	  -1
c    	17779856	17779856	  +0
g    	17756017	17756016	  +1
t    	32365689	32365689	  +0

Total	100267450	100267450	  


Chromosomal Changes:
--------------------

Chromosome: I
7301405 7301404 0   ->   7301405 7301405 1
9606432 9606431 0   ->   9606433 9606433 1

Chromosome: III
9778413 9778413 1   ->   9778413 9778412 0
9863640 9863639 0   ->   9863639 9863639 1

Chromosome: V
10766209 10766209 1   ->   10766209 10766208 0

Chromosome: X
11848274 11848274 1   ->   11848274 11848273 0


Gene data set (Live C.elegans genes 24123)
------------------------------------------
Molecular_info              22418 (92.9%)
Concise_description          4732 (19.6%)
Reference                    7097 (29.4%)
CGC_approved Gene name       9279 (38.5%)
RNAi_result                 19875 (82.4%)
Microarray_results          19569 (81.1%)
SAGE_transcript             0 (0%)




Wormpep data set:
----------------------------

There are 20140 CDS in autoace, 23412 when counting 3272 alternate splice forms.

The 23412 sequences contain 10,288,612 base pairs in total.

Modified entries      52
Deleted entries       0
New entries           62
Reappeared entries    2

Net change  +64


Status of entries: Confidence level of prediction (based on the amount of transcript evidence)
-------------------------------------------------
Confirmed              8020 (34.3%)	Every base of every exon has transcription evidence (mRNA, EST etc.)
Partially_confirmed   10747 (45.9%)	Some, but not all exon bases are covered by transcript evidence
Predicted              4645 (19.8%)	No transcriptional evidence at all



Status of entries: Protein Accessions
-------------------------------------
UniProtKB/Swiss-Prot accessions   3544 (15.1%)
UniProtKB/TrEMBL accessions     19448 (83.1%)



Status of entries: Protein_ID's in EMBL
---------------------------------------
Protein_id            22992 (98.2%)



Gene <-> CDS,Transcript,Pseudogene connections (cgc-approved)
---------------------------------------------
Entries with CGC-approved Gene name   7641


GeneModel correction progress WS176 -> WS177
-----------------------------------------
Confirmed introns not in a CDS gene model;

          +---------+--------+
          | Introns | Change |
          +---------+--------+
Cambridge |      0  |   -70  |
St Louis  |      0  |  -179  |
          +---------+--------+


Members of known repeat families that overlap predicted exons;

            +---------+--------+
            | Repeats | Change |
            +---------+--------+
Cambridge	|      0  |    -6  |
St Louis 	|      0  |    -6  |
            +---------+--------+



Synchronisation with GenBank / EMBL:
------------------------------------

CHROMOSOME_V	sequence Z72508
CHROMOSOME_X	sequence Z67755

There are no gaps remaining in the genome sequence
---------------
For more info mail [email protected]
-===================================================================================-



New Data:
---------

New orthology data from user submissions was added and curated.

EnsEMBL orthologues from EnsEMBL-compara release 44 were imported to update the ortholog_other EnsEMBL data.

Large increases of Anatomy_term and Anatomy_name have been made in order to clearly distinguish the identity of a cell (e.g. ABalapp) from its nucleus (e.g. ABalapp nucleus).

Transcript alignment data from non C.elegans Caenorhabditis species (C.briggsae / C. brenneri / C.remanei / C.japonica) to the C.elegans genome was added to WormBase.

Genome sequence updates:
-----------------------

7 changes were made to the genome sequence:

F54F7   deletion  tagctcaccagcttgcacgGgaagtgaaagtcttgaaata
F28H7   deletion  aacaaaatcttgcaactagTaatgtgaaaaagtgtggact
K07A1   insertion ttctcaaatttcagtttatTggaacattacaaatatgtgt
F13G3   insertion tttttttcagacaccgttcgtttggctccgGcgcgatcaacatggtgatggttgcacaagg
R10E11  deletion  gccacctggaaatcaatcagctcctcaaaaAgaattccgaatctgcctatattctgttcta
K11H3   insertion gcattaacaacacacggaaatcgaaatggaCcacttcgttatagtcttcttcaacaacgag
Y95D11A shift-overlap GTTATATATTTTTTTGGAAATTTATAACTCTTAAAAAAATTCAATTTTTTCAAATAAATAAAATTTCAGATGGCTTCTCAACCGGAGCTCATAATGGTTG
ACGAGCAAGTCGTCGCTTATGAAGTAGAAATTGATAGTTTTGATGTAAAATATGATGAAGAGGAACATGATGGTCAAGGGACACAAGATGAACCATTTTC
TCATGGTACGGAACAGTTTTACGCTGAAAAATTCCAGAATTCCAAAAAATGAAACCTAAAATAGTGATAAAAAGGCGTTTTGAATATTAAATTGAAGAAA
AAAATCAGCAAAAATTGTTCAAAATCAAGAATTTTAACGGAAAAGTGTAAAATCTTCTCCACGGGGAGTACACATGCTTCGTAAATCGACATATGGTCAA
TTTTAAAGTTTTGAAAATTGAAATGCCGGCAAAAAATCTTTTCTTGTTTTTTTTTCGCAAAAAATTCAATTTTCGAAAAAATAATTATAGAAAATTGCAT
TTTTTGACCGAAAAGTCAATAAAAATAACAGAAAAAATCGATAAACCGTTGAAAAATTTTTTTTTAATTCAAAAATTCAGAAATTCTTAAAATTCAAATT
TCCAGATGAGCCAAGCACCAGCGGTTATCACCATCACTACCAATTTCCCAATGACGTGGATCCAAATGATGTTTATTTATTCGATGAGGTATCAATTATC
CGAAATTTGGCGATTTTTGAGCCAAAACTACGGTACCCGGTCTCGACACGACAATTTTTGTTAAATTAAAAAAGGTGTGCGCCTTTGAAGGTTACTGTAG
TTTCGAACTTTTGCTGATTTTTCATATTTTTTCGTTGAAAACAAAAGTATTTATTTGTTGAAAATCAGAAAATATTATCTTCGCGTCGAGACCTATTACC
ATTCTATTTTTGCCGCAAAAAACAAAATTTCCTTTAAAAAAAAGCTAATTTTTCCAAGTTTTTCCAGGAAACTGATCAAATTCATCAGCTCGACCCGAAT
CAACTCAAAAATAATGAAGAAATTGACGATGTCGAATATATTGATCAATCTGTGCCTTCCACGTCATCAATGATGACGTCACTGCCGTCAACGGTGGCTC
CAGTTCAGCCAAATACGTATTACAGACGGAAATCTGGAGGCCCAACTGCAACTGGAAATGAAAAACCGAATTATAGGCCGTTGGCGTTCCAAACGGTTCG
taaaataaaaaaaatgtccatgtgtcgatt

New Fixes:
----------


Known Problems:
---------------


Other Changes:
--------------

Proposed Changes / Forthcoming Data:
-------------------------------------

Additional genome changes are planned for WS178.


Model Changes:
------------------------------------


-===================================================================================-


Quick installation guide for UNIX/Linux systems
-----------------------------------------------

1. Create a new directory to contain your copy of WormBase,
	e.g. /users/yourname/wormbase

2. Unpack and untar all of the database.*.tar.gz files into
	this directory. You will need approximately 2-3 Gb of disk space.

3. Obtain and install a suitable acedb binary for your system
	(available from www.acedb.org).

4. Use the acedb 'xace' program to open your database, e.g.
	type 'xace /users/yourname/wormbase' at the command prompt.

5. See the acedb website for more information about acedb and
	using xace.

____________  END _____________