Invisible encryption (DNA encryption)

Stefan Claas <[email protected]>
Newsgroups alt.privacy.anon-server,alt.cypherpunks,alt.privacy
Organization Victor Usenet Postings
Message-ID <[email protected]> 
Hi all,

maybe useful with Microsoft DNA ink or other cheap DNA kits,
so that you don't need a laboratory.

C:\Users\xxxxxxxx\Desktop>dnacrypt genkey 52 key.txt
Random DNA key of length 52 generated using TPM 2.0 and saved to 'key.txt'.

C:\Users\xxxxxxxx\Desktop>dnaentropy key.txt
Shannon entropy of the DNA key (52 bases): 1.9397
✔ The key has high entropy and appears well-distributed.

C:\Users\xxxxxxxx\Desktop>dnacrypt encrypt msg.txt key.txt out.txt
Plaintext as DNA (first 20 bases): TACATCTTTCGATCGATCGG...
Encryption complete. Ciphertext DNA saved to 'out.txt'.

Ciphertext: GGTAGGTTCAGCGAGGGCCGGTCATCATAGACCTGATGAGCTTCGCCT

https://github.com/Ch1ffr3punk/DNAcrypt

Regards
Stefan
lmpx.com only provides a reader for public news (NNTP) servers. It is not affiliated with the servers or forums shown here and is not responsible for the content of articles, which is written by their respective authors.