Re: Invisible encryption (DNA encryption)
Stefan Claas <[email protected]>
| Newsgroups | alt.privacy.anon-server,alt.cypherpunks,alt.privacy |
|---|---|
| Organization | Victor Usenet Postings |
| Message-ID | <[email protected]> |
Stefan Claas wrote: > > Hi all, > > maybe useful with Microsoft DNA ink or other cheap DNA kits, > so that you don't need a laboratory. > > C:\Users\xxxxxxxx\Desktop>dnacrypt genkey 52 key.txt > Random DNA key of length 52 generated using TPM 2.0 and saved to 'key.txt'. > > C:\Users\xxxxxxxx\Desktop>dnaentropy key.txt > Shannon entropy of the DNA key (52 bases): 1.9397 > ✔ The key has high entropy and appears well-distributed. > > C:\Users\xxxxxxxx\Desktop>dnacrypt encrypt msg.txt key.txt out.txt > Plaintext as DNA (first 20 bases): TACATCTTTCGATCGATCGG... > Encryption complete. Ciphertext DNA saved to 'out.txt'. > > Ciphertext: GGTAGGTTCAGCGAGGGCCGGTCATCATAGACCTGATGAGCTTCGCCT > > https://github.com/Ch1ffr3punk/DNAcrypt https://punnettsquare.org/gccontent/ Regards Stefan